ID: 1032896498

View in Genome Browser
Species Human (GRCh38)
Location 7:136256860-136256882
Sequence CTCCATCTACAGAGGAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032896498_1032896503 4 Left 1032896498 7:136256860-136256882 CCCTGGTTCCTCTGTAGATGGAG No data
Right 1032896503 7:136256887-136256909 GAAGGAGACAGCCATCTGTTTGG No data
1032896498_1032896504 8 Left 1032896498 7:136256860-136256882 CCCTGGTTCCTCTGTAGATGGAG No data
Right 1032896504 7:136256891-136256913 GAGACAGCCATCTGTTTGGATGG No data
1032896498_1032896505 13 Left 1032896498 7:136256860-136256882 CCCTGGTTCCTCTGTAGATGGAG No data
Right 1032896505 7:136256896-136256918 AGCCATCTGTTTGGATGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032896498 Original CRISPR CTCCATCTACAGAGGAACCA GGG (reversed) Intergenic
No off target data available for this crispr