ID: 1032899030

View in Genome Browser
Species Human (GRCh38)
Location 7:136285415-136285437
Sequence TTATTATCCTACATCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032899030_1032899031 8 Left 1032899030 7:136285415-136285437 CCAATATAGATGTAGGATAATAA No data
Right 1032899031 7:136285446-136285468 TAGAAAATCTGAATTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032899030 Original CRISPR TTATTATCCTACATCTATAT TGG (reversed) Intergenic
No off target data available for this crispr