ID: 1032901923

View in Genome Browser
Species Human (GRCh38)
Location 7:136320354-136320376
Sequence GCACCAGTGTTAGCAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032901920_1032901923 3 Left 1032901920 7:136320328-136320350 CCTTAGGCACCAGGTGGACAATG No data
Right 1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG No data
1032901922_1032901923 -6 Left 1032901922 7:136320337-136320359 CCAGGTGGACAATGCTGGCACCA No data
Right 1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG No data
1032901919_1032901923 8 Left 1032901919 7:136320323-136320345 CCTATCCTTAGGCACCAGGTGGA No data
Right 1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032901923 Original CRISPR GCACCAGTGTTAGCAGATCC AGG Intergenic
No off target data available for this crispr