ID: 1032913375

View in Genome Browser
Species Human (GRCh38)
Location 7:136459514-136459536
Sequence CAAGTTTCTCTCTTGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032913372_1032913375 3 Left 1032913372 7:136459488-136459510 CCTTCCGCAGTTCAGTAATTCTG No data
Right 1032913375 7:136459514-136459536 CAAGTTTCTCTCTTGGATGTTGG No data
1032913373_1032913375 -1 Left 1032913373 7:136459492-136459514 CCGCAGTTCAGTAATTCTGCAGC No data
Right 1032913375 7:136459514-136459536 CAAGTTTCTCTCTTGGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032913375 Original CRISPR CAAGTTTCTCTCTTGGATGT TGG Intergenic
No off target data available for this crispr