ID: 1032914528

View in Genome Browser
Species Human (GRCh38)
Location 7:136474576-136474598
Sequence CCCCATTAAAAAGTGTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032914528_1032914530 22 Left 1032914528 7:136474576-136474598 CCTATGTACACTTTTTAATGGGG No data
Right 1032914530 7:136474621-136474643 TTTAAGTACCTTATAGATTCTGG 0: 9
1: 693
2: 3945
3: 8741
4: 19182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032914528 Original CRISPR CCCCATTAAAAAGTGTACAT AGG (reversed) Intergenic
No off target data available for this crispr