ID: 1032918233

View in Genome Browser
Species Human (GRCh38)
Location 7:136515462-136515484
Sequence AACTCTCTCTAGCAATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032918233_1032918239 13 Left 1032918233 7:136515462-136515484 CCATCCTATTGCTAGAGAGAGTT No data
Right 1032918239 7:136515498-136515520 ACAGGGAAAGAGAGAGCCTGGGG No data
1032918233_1032918237 11 Left 1032918233 7:136515462-136515484 CCATCCTATTGCTAGAGAGAGTT No data
Right 1032918237 7:136515496-136515518 TCACAGGGAAAGAGAGAGCCTGG No data
1032918233_1032918235 -5 Left 1032918233 7:136515462-136515484 CCATCCTATTGCTAGAGAGAGTT No data
Right 1032918235 7:136515480-136515502 GAGTTAGACAAATATATCACAGG No data
1032918233_1032918238 12 Left 1032918233 7:136515462-136515484 CCATCCTATTGCTAGAGAGAGTT No data
Right 1032918238 7:136515497-136515519 CACAGGGAAAGAGAGAGCCTGGG No data
1032918233_1032918236 -4 Left 1032918233 7:136515462-136515484 CCATCCTATTGCTAGAGAGAGTT No data
Right 1032918236 7:136515481-136515503 AGTTAGACAAATATATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032918233 Original CRISPR AACTCTCTCTAGCAATAGGA TGG (reversed) Intergenic
No off target data available for this crispr