ID: 1032932032

View in Genome Browser
Species Human (GRCh38)
Location 7:136683729-136683751
Sequence ATGCTAGGTTGCAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032932029_1032932032 -4 Left 1032932029 7:136683710-136683732 CCTCAAAGCATAGGTGCTGATGC No data
Right 1032932032 7:136683729-136683751 ATGCTAGGTTGCAGGAAAACAGG No data
1032932028_1032932032 -1 Left 1032932028 7:136683707-136683729 CCTCCTCAAAGCATAGGTGCTGA No data
Right 1032932032 7:136683729-136683751 ATGCTAGGTTGCAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032932032 Original CRISPR ATGCTAGGTTGCAGGAAAAC AGG Intergenic
No off target data available for this crispr