ID: 1032932978

View in Genome Browser
Species Human (GRCh38)
Location 7:136695236-136695258
Sequence GGTTCCCGCATCTGCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032932978_1032932985 7 Left 1032932978 7:136695236-136695258 CCAACCCTGCAGATGCGGGAACC No data
Right 1032932985 7:136695266-136695288 TCTCAGTATAAGCAGGCCATAGG No data
1032932978_1032932983 0 Left 1032932978 7:136695236-136695258 CCAACCCTGCAGATGCGGGAACC No data
Right 1032932983 7:136695259-136695281 AGGCCAATCTCAGTATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032932978 Original CRISPR GGTTCCCGCATCTGCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr