ID: 1032938331

View in Genome Browser
Species Human (GRCh38)
Location 7:136759957-136759979
Sequence GTGCCTTTCTAGAAAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032938326_1032938331 2 Left 1032938326 7:136759932-136759954 CCAACTAGTCAGGTTCCTTCACA No data
Right 1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG No data
1032938325_1032938331 3 Left 1032938325 7:136759931-136759953 CCCAACTAGTCAGGTTCCTTCAC No data
Right 1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032938331 Original CRISPR GTGCCTTTCTAGAAAAGGGA GGG Intergenic
No off target data available for this crispr