ID: 1032940342

View in Genome Browser
Species Human (GRCh38)
Location 7:136781317-136781339
Sequence CCACTACTGTTCACAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032940342_1032940355 12 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940355 7:136781352-136781374 GAGAATTTGGGGATGGTTAATGG No data
1032940342_1032940350 -10 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940350 7:136781330-136781352 ACAGTAGTGGGTGGGGGTCAGGG No data
1032940342_1032940351 -1 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940351 7:136781339-136781361 GGTGGGGGTCAGGGAGAATTTGG No data
1032940342_1032940356 13 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940356 7:136781353-136781375 AGAATTTGGGGATGGTTAATGGG No data
1032940342_1032940354 5 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940354 7:136781345-136781367 GGTCAGGGAGAATTTGGGGATGG No data
1032940342_1032940353 1 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940353 7:136781341-136781363 TGGGGGTCAGGGAGAATTTGGGG No data
1032940342_1032940352 0 Left 1032940342 7:136781317-136781339 CCAGAGGCTGTGAACAGTAGTGG No data
Right 1032940352 7:136781340-136781362 GTGGGGGTCAGGGAGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032940342 Original CRISPR CCACTACTGTTCACAGCCTC TGG (reversed) Intergenic
No off target data available for this crispr