ID: 1032940405

View in Genome Browser
Species Human (GRCh38)
Location 7:136782139-136782161
Sequence GTGAGTATGTACTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032940405_1032940406 -9 Left 1032940405 7:136782139-136782161 CCTGACACAGAGTACATACTCAC No data
Right 1032940406 7:136782153-136782175 CATACTCACTAAATATCTGTAGG No data
1032940405_1032940407 20 Left 1032940405 7:136782139-136782161 CCTGACACAGAGTACATACTCAC No data
Right 1032940407 7:136782182-136782204 GAATCAGTTTAAGATCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032940405 Original CRISPR GTGAGTATGTACTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr