ID: 1032941635

View in Genome Browser
Species Human (GRCh38)
Location 7:136799468-136799490
Sequence CTCCTCAGGGAAGGTATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032941635_1032941640 19 Left 1032941635 7:136799468-136799490 CCACAGATACCTTCCCTGAGGAG No data
Right 1032941640 7:136799510-136799532 CCTTACTTTTATTGTAACTGTGG No data
1032941635_1032941641 26 Left 1032941635 7:136799468-136799490 CCACAGATACCTTCCCTGAGGAG No data
Right 1032941641 7:136799517-136799539 TTTATTGTAACTGTGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032941635 Original CRISPR CTCCTCAGGGAAGGTATCTG TGG (reversed) Intergenic
No off target data available for this crispr