ID: 1032943529

View in Genome Browser
Species Human (GRCh38)
Location 7:136823568-136823590
Sequence ATATGTCCCTTGCAATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032943529_1032943533 21 Left 1032943529 7:136823568-136823590 CCCCCAAATTGCAAGGGACATAT No data
Right 1032943533 7:136823612-136823634 TCAAATCTCTCTCCCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032943529 Original CRISPR ATATGTCCCTTGCAATTTGG GGG (reversed) Intergenic
No off target data available for this crispr