ID: 1032945837

View in Genome Browser
Species Human (GRCh38)
Location 7:136851556-136851578
Sequence AAGGGCTATTTCAAGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032945830_1032945837 22 Left 1032945830 7:136851511-136851533 CCACACGGACCTGATATTCAATG No data
Right 1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG No data
1032945829_1032945837 25 Left 1032945829 7:136851508-136851530 CCTCCACACGGACCTGATATTCA No data
Right 1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG No data
1032945831_1032945837 13 Left 1032945831 7:136851520-136851542 CCTGATATTCAATGTAGACTGCA No data
Right 1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032945837 Original CRISPR AAGGGCTATTTCAAGTGGAG TGG Intergenic
No off target data available for this crispr