ID: 1032949764

View in Genome Browser
Species Human (GRCh38)
Location 7:136894023-136894045
Sequence GTGAATAATACTAGGACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032949764 Original CRISPR GTGAATAATACTAGGACTCT AGG (reversed) Intronic
901043289 1:6378867-6378889 AATAATAAAACTAGGACTCTAGG - Intronic
901827535 1:11872171-11872193 GTGAATAAGACTTTGTCTCTAGG + Intergenic
902966839 1:20011237-20011259 GTCTGTAATACTAGGACTTTGGG + Intergenic
905730856 1:40298613-40298635 GGGAATAAAACTCGGACACTGGG + Intergenic
906132787 1:43471018-43471040 GTGAAAAATTCTAGGTTTCTGGG - Intergenic
906671850 1:47661539-47661561 GAGAATAATGCTAGTACTCATGG - Intergenic
907598890 1:55746795-55746817 GTGAATATTAGAAGGACCCTAGG - Intergenic
907706158 1:56834542-56834564 CTGAAGATTACCAGGACTCTGGG + Intergenic
908194449 1:61735346-61735368 GTCTATAATCCTAGCACTCTGGG + Intergenic
908732606 1:67241766-67241788 GAGAATAATACTAAGAGTTTGGG + Intronic
913433678 1:118824674-118824696 TTGAATAAGACTAGAATTCTAGG + Intergenic
916547688 1:165821871-165821893 GTGAATAAAACACGGATTCTGGG + Intronic
916735072 1:167600394-167600416 ATGAACAATGCCAGGACTCTCGG + Intergenic
918979101 1:191532153-191532175 GTGAATATTGTTAAGACTCTTGG + Intergenic
919491755 1:198213158-198213180 GTGAATCCTTCTATGACTCTCGG - Intronic
919694812 1:200563655-200563677 GCCTATAATACTAGGACTTTGGG - Intronic
921104974 1:211967510-211967532 GTGATAAAAACTAGGACTGTTGG + Intronic
923935538 1:238755672-238755694 GTTAACAATACTATTACTCTGGG + Intergenic
1063624964 10:7680141-7680163 GTGTATAAGCCAAGGACTCTGGG + Intergenic
1066591266 10:36996936-36996958 CTGAAAAATACAAGGACTGTTGG + Intergenic
1068693073 10:59938142-59938164 TTGATAAATACTAGGAATCTTGG + Intergenic
1068790368 10:61023787-61023809 GAGAAAAAAATTAGGACTCTAGG + Intergenic
1071668524 10:87584756-87584778 GCTAATAATCCTAGCACTCTGGG - Intergenic
1078259472 11:9691175-9691197 GCCAATAATCCTAGCACTCTGGG - Intronic
1079195686 11:18324383-18324405 TTGAAAAATACTAGGAAACTTGG + Intronic
1079750701 11:24192485-24192507 ATGAATTATCCTAGGACCCTGGG - Intergenic
1080507236 11:32927284-32927306 GTGAATTATACTACGAGTCTGGG + Intronic
1087988597 11:104717509-104717531 GTGAATAAAAATAAAACTCTTGG + Intergenic
1095510471 12:42946119-42946141 ATGATTCATTCTAGGACTCTGGG + Intergenic
1096288558 12:50321865-50321887 GTAAATAATACCAGCACTTTGGG + Intergenic
1098152323 12:67559618-67559640 TTGTATAATGCTAGCACTCTTGG - Intergenic
1099581672 12:84455596-84455618 GTAAATATTTCTGGGACTCTGGG + Intergenic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1105271497 13:18880419-18880441 GTCAATAATCCCAGCACTCTGGG + Intergenic
1109927031 13:69157332-69157354 GTGAATAATGCTATGAATATTGG - Intergenic
1117869206 14:60181672-60181694 ATGAATAATACTATGAATATTGG + Intergenic
1118228182 14:63922541-63922563 GTGTATAATCCTAGCACTGTGGG + Intronic
1126159941 15:45601614-45601636 ATGAATAATACTAATACTTTGGG + Intronic
1126942147 15:53778921-53778943 GTGAATAACATTTGGCCTCTAGG + Intergenic
1128010501 15:64291012-64291034 GTGATTAAAAATAGGAGTCTTGG - Intronic
1128031551 15:64484981-64485003 GTGAAAGAAACTAGGAATCTTGG + Intronic
1129946300 15:79541988-79542010 ATGAACAATACAAGGACTCAGGG + Intergenic
1132228120 15:100159751-100159773 GTGACTCAGACTAGGACTCCAGG - Intronic
1132258200 15:100396742-100396764 GTGTATAATCCTAGCACTTTGGG - Intergenic
1135272218 16:21079279-21079301 GAGAATAATATTAGGACGGTAGG + Intronic
1141403887 16:83774631-83774653 GTCTATAATCCTAGCACTCTGGG - Intronic
1141948102 16:87323956-87323978 GGGAATAAAACTTGGGCTCTTGG - Intronic
1141976719 16:87521175-87521197 GTCCATAATCCCAGGACTCTGGG + Intergenic
1149024733 17:52013963-52013985 GTGAATATAAATAGAACTCTAGG + Intronic
1151130720 17:71893761-71893783 GTGAATAATATGAGCACCCTTGG + Intergenic
1152967236 18:128377-128399 TTGAATAATAGTAGGAATCCTGG - Intergenic
1153050926 18:902430-902452 GTGAATTGTACAAGGAGTCTTGG + Intergenic
1154926749 18:20943678-20943700 TTGAATAATAGTAGGAATCCTGG + Intergenic
1155827032 18:30458627-30458649 ATGAATTCTACTGGGACTCTTGG - Intergenic
1155957102 18:31963365-31963387 TTGAAAACCACTAGGACTCTTGG + Intergenic
1156261578 18:35449301-35449323 GTATATAATACCAGGACTCTGGG + Intronic
1161330793 19:3686457-3686479 GTGTGTAATCCTAGCACTCTGGG + Intronic
1164878517 19:31711161-31711183 GTCAATAATCCTAGCACTTTGGG - Intergenic
1166073783 19:40402011-40402033 GTGCATAATCCTAGCACTTTGGG - Intronic
1167452784 19:49581937-49581959 GGGGATAATAATAGGACTCCTGG + Intronic
925601272 2:5610970-5610992 CTGACTAATACAGGGACTCTGGG - Intergenic
926793717 2:16601260-16601282 GTGAAGAATACTGGGAATCCGGG + Intronic
928452960 2:31395188-31395210 GAGACTAATCCTAGGACTATAGG - Intronic
930228237 2:48816482-48816504 GTGAATAATACATGGACACATGG - Intergenic
930650002 2:53954918-53954940 GTCTATAATCCTAGCACTCTGGG + Intronic
931076583 2:58721290-58721312 GTCATTAATTCTTGGACTCTGGG + Intergenic
932346062 2:70995802-70995824 GTGAATAATGCTATGAATATTGG - Intergenic
932536647 2:72604241-72604263 GTGAATAATGCTAGCTCTCAGGG - Intronic
935232147 2:101108379-101108401 CTGAATAAGACCTGGACTCTGGG + Intronic
935284524 2:101552367-101552389 CTTAAAAATACAAGGACTCTAGG + Intergenic
936108209 2:109643820-109643842 TTGAGTAATAATAGAACTCTGGG + Intergenic
939364289 2:141212541-141212563 GTGTGTAATCCTAGCACTCTGGG - Intronic
942360868 2:175170104-175170126 GTAAAGAATTTTAGGACTCTTGG - Intergenic
944693643 2:202181227-202181249 GTGTATAATCCCAGGACTTTGGG - Intronic
946354069 2:219173899-219173921 GTCTATAATCCTAGCACTCTGGG - Intronic
946534455 2:220610756-220610778 GTGAATACTCCTAGGCCTCAGGG + Intergenic
1173899257 20:46575301-46575323 ACTAATAATACTAGGACTCGAGG - Intronic
1174187826 20:48719627-48719649 CAGAATAATAGAAGGACTCTGGG + Intronic
1174518436 20:51111462-51111484 GTAAATAATTCAAGGGCTCTTGG + Intergenic
1176729526 21:10478923-10478945 GTAAATTATACAAGGACTGTGGG - Intergenic
1178027628 21:28486353-28486375 GTCTATAATACTAGCACTTTGGG + Intergenic
1181515568 22:23409782-23409804 GTGTATTAGTCTAGGACTCTGGG + Intergenic
1184578311 22:45392958-45392980 GTCTATAATCCTAGCACTCTAGG - Intronic
952715764 3:36478886-36478908 GTGTATAATCCCAGGACTTTGGG - Intronic
955322121 3:57981901-57981923 ATGAATAATGCTCGGACTGTAGG - Intergenic
957307170 3:78472682-78472704 TTGAATAATATTAAGATTCTTGG + Intergenic
958918947 3:100081206-100081228 GTGAAGATTAGAAGGACTCTTGG - Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
960539734 3:118849736-118849758 GGGACTAATACTAGGTCTCCGGG - Intergenic
961254291 3:125534119-125534141 ATGAATAATTCTAGCACTTTGGG + Intronic
961505629 3:127369053-127369075 TTGAATAATTTTGGGACTCTGGG + Intergenic
961687490 3:128644389-128644411 GCCTATAATCCTAGGACTCTGGG + Intronic
962723753 3:138201409-138201431 GGGAAGAAGACAAGGACTCTAGG - Intronic
962757418 3:138476278-138476300 GTGAAAAATAGTAGGCCACTTGG + Exonic
963469316 3:145718491-145718513 GTGAATAAGAGTAGGGGTCTGGG + Intergenic
965875963 3:173320472-173320494 GAGAATAATAAAAGGAGTCTTGG + Intergenic
966297938 3:178445465-178445487 GTTAATAATATTATTACTCTTGG + Intronic
967907569 3:194514298-194514320 GTGAATAAGATTGGGAATCTTGG + Intergenic
970502749 4:16694720-16694742 GAGAATAAAGCTATGACTCTTGG - Intronic
973314982 4:48750199-48750221 GCGTATAATACTAGCACTCTGGG + Intronic
973984894 4:56341136-56341158 GTAAATAGTAGTAGGACTGTTGG - Intronic
974891163 4:67885886-67885908 GTGAATAGTAATAGGGCACTGGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
979516257 4:121613409-121613431 GTAAATAATCCTAGCACTTTGGG - Intergenic
979577934 4:122317355-122317377 GTGAAAAACACTAGGACACTAGG - Intronic
981591780 4:146372192-146372214 GTCCATAATTCTAGCACTCTGGG + Intronic
981611219 4:146595793-146595815 GTCTATAATCCTAGGACTTTGGG - Intergenic
983295584 4:165863926-165863948 GTGAATAATACTATGCTTTTAGG + Intergenic
983967966 4:173836723-173836745 GTGACTTATACTGGGGCTCTAGG - Intergenic
984740950 4:183162537-183162559 GGGAATACTACTAAGAGTCTAGG - Intronic
987155371 5:15083847-15083869 GTGTGTAATACTAGCACTTTGGG + Intergenic
988341994 5:29984741-29984763 CTGAAAAATATTAGGACACTAGG - Intergenic
989206292 5:38811845-38811867 TTGACTAATAATATGACTCTTGG - Intergenic
991117158 5:62967754-62967776 TAGAATAATTCTAGGACTTTTGG + Intergenic
992719252 5:79543630-79543652 GTGTATAATCCTAGCACTTTGGG - Intergenic
993094439 5:83465337-83465359 GGGAATCAAACTAGGTCTCTGGG + Intergenic
993243235 5:85416575-85416597 CTGTCTAATTCTAGGACTCTGGG - Intergenic
993515100 5:88822440-88822462 GTGAATAATACTAAGATTTATGG - Intronic
994319171 5:98370411-98370433 GTGAATAATGCTAGGAACGTCGG + Intergenic
997541343 5:134665494-134665516 GTCTATAATACCAGGACTTTGGG - Intronic
998027906 5:138836149-138836171 ATGAATAAATCTAGAACTCTTGG - Intronic
998136131 5:139675632-139675654 GTGACTAACACTTGGGCTCTGGG + Intronic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
1002952799 6:1832093-1832115 GTCTATAATCCTAGCACTCTGGG + Intronic
1009831143 6:68937394-68937416 ATAAGTAATAATAGGACTCTGGG + Intronic
1010584740 6:77643779-77643801 TTGAATAATAATAGGAATGTAGG + Intergenic
1012826728 6:104155360-104155382 ATGAATAATCCTAGCACTTTTGG - Intergenic
1015922889 6:138282787-138282809 GCCAATAATCCTAGGACTTTGGG + Intronic
1017270310 6:152495959-152495981 ATATATAATACTAGGAGTCTGGG + Intronic
1020749260 7:12119869-12119891 GTGAAAAATACCATGACTTTAGG + Intergenic
1022224409 7:28348087-28348109 CTGAATAACACAAGGAATCTCGG - Intronic
1022280430 7:28903292-28903314 ATGAATAATACTAAGACCCAGGG + Intergenic
1023053525 7:36273663-36273685 GTGCATGATTCTAGAACTCTGGG - Intronic
1028576751 7:92360533-92360555 GTGAATAATACTGTGAATGTTGG + Intronic
1031974272 7:128084126-128084148 TTGAATAATACTGAGGCTCTAGG + Intronic
1032220378 7:129989908-129989930 GTGATCAATCCTAAGACTCTGGG + Intergenic
1032617160 7:133485658-133485680 GTGAATAAGGCTTGCACTCTGGG - Intronic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1033366366 7:140674981-140675003 GTGTGTAATCCTAGGACTTTGGG + Intronic
1034928752 7:155143953-155143975 TTGAATAATTCTAGCCCTCTGGG + Intergenic
1039771370 8:40690652-40690674 TTGAATAATACATGCACTCTAGG - Intronic
1046278559 8:111993811-111993833 GTCAGTGATATTAGGACTCTGGG - Intergenic
1047859239 8:128946476-128946498 ATGAATAATTCTAGAGCTCTGGG - Intergenic
1052454120 9:28672191-28672213 GTGCAGAATAGTAGGACACTAGG + Intergenic
1055411622 9:76036308-76036330 GTGAATAACACTGGGTCTGTAGG + Intronic
1055731146 9:79280467-79280489 GTGAATGATACTGCAACTCTGGG + Intergenic
1060644325 9:125264976-125264998 GCCAATAATCCTAGCACTCTGGG - Intronic
1192116866 X:68419799-68419821 GTCCATAATACCAGGACTTTGGG - Intronic
1195420266 X:104667622-104667644 GTGATTAAGAGCAGGACTCTGGG - Intronic
1195914041 X:109918065-109918087 ATGAATACTACTAGAACACTGGG - Intergenic
1195982848 X:110598579-110598601 GTCAGTAATCCTAGGACTTTGGG - Intergenic
1197807093 X:130407917-130407939 GTGCATAATACCAGCACTTTGGG - Intronic
1202193093 Y:22264751-22264773 GAGAACAATACTAGGATACTAGG + Intergenic