ID: 1032954196

View in Genome Browser
Species Human (GRCh38)
Location 7:136951446-136951468
Sequence TACAGCTGGTCAGCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032954196 Original CRISPR TACAGCTGGTCAGCAAAGCC AGG (reversed) Intronic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
901686545 1:10946654-10946676 CACAGCTGGGCATCTAAGCCAGG + Exonic
903641733 1:24864715-24864737 TAAAGCCGTTCAGCAAGGCCAGG + Intergenic
905209485 1:36363859-36363881 TACATCTTGTCAGCCAAGCGCGG + Intronic
905234920 1:36539587-36539609 CTCAGCTGGTTTGCAAAGCCAGG + Intergenic
906063503 1:42963315-42963337 GGCAGCTGGACAGAAAAGCCTGG - Intergenic
907367718 1:53976462-53976484 TAAAGGTGGTCAGAAAAGCTGGG - Intergenic
907400192 1:54220466-54220488 TACAGCTGATCTGCAAAGTGGGG + Intronic
907495878 1:54844254-54844276 TAGAGAAGGTCAGCAAGGCCAGG + Intergenic
907537162 1:55174220-55174242 GACAGCTCGTGAGAAAAGCCTGG + Intronic
909474164 1:76063354-76063376 TAATGCTGGTCAGCTATGCCTGG + Intergenic
914967949 1:152277898-152277920 TACAGGTTGTCAGGAAAGTCGGG - Intergenic
916507509 1:165441366-165441388 CACAGTTGCTCTGCAAAGCCAGG - Intronic
917611000 1:176689054-176689076 GCCAGCTGGGCAGCACAGCCAGG + Intronic
917728955 1:177855074-177855096 CACAGCTGGGCACCAGAGCCTGG - Intergenic
918417190 1:184322589-184322611 TACAGATGGTCAACAAAGATGGG - Intergenic
921722916 1:218493297-218493319 TACACCTGGGAAGCCAAGCCAGG - Intergenic
923212317 1:231814821-231814843 TGCAGATGGTCAGCCAGGCCAGG + Intronic
923276508 1:232401298-232401320 GACAGCTGGTCACCCAAGCTGGG + Intronic
923688805 1:236173573-236173595 TGCTGCTGGTCAGCAAATGCAGG - Intronic
924456979 1:244226763-244226785 TACACCTGGTCAGTACAGACTGG - Intergenic
1063572295 10:7227363-7227385 CACAGCTGGGCAGCAAGTCCAGG + Intronic
1075180367 10:120205636-120205658 TACAGCTGGAATACAAAGCCAGG + Intergenic
1078856426 11:15209205-15209227 TAGAGCTGGGCACCAAACCCAGG - Intronic
1082203714 11:49405408-49405430 TAGAGCTGGTCTTCAAACCCAGG - Intergenic
1083290589 11:61687864-61687886 CACAGCTGCCCAGCAGAGCCAGG - Intronic
1083341840 11:61963199-61963221 AACATCTGCTCAGCTAAGCCTGG - Exonic
1083884508 11:65565527-65565549 TAAAGCTGATGAGCAAGGCCGGG - Intergenic
1084911413 11:72392379-72392401 TCTGGCTGGTCAGGAAAGCCGGG + Intronic
1085803923 11:79617334-79617356 TACAATTTGTCAGCCAAGCCAGG - Intergenic
1088515980 11:110634332-110634354 TACAGCTGGTGAGGAAGGACAGG + Intronic
1088638255 11:111845495-111845517 TAAAGCTTCTCAGCAAGGCCTGG - Intronic
1089324549 11:117648205-117648227 CACAGCTGGGCAGAAAAACCAGG - Intronic
1089748693 11:120634963-120634985 GGCAGCTGGGGAGCAAAGCCTGG + Intronic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1091693887 12:2615288-2615310 TGAAGCTTGTCAGCAAAGACAGG + Intronic
1094277026 12:28689181-28689203 CACTGTTGGTCAGCAGAGCCAGG + Intergenic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1101125695 12:101631655-101631677 TGGACCTGGCCAGCAAAGCCGGG + Exonic
1102033510 12:109758326-109758348 TACAGGTGCTCAGAAAAGGCTGG - Intronic
1103898383 12:124289652-124289674 GACAGCTGCCCAGCAAAGGCGGG + Intronic
1110095817 13:71518844-71518866 TACAGCTAGTGAGCAAAGAATGG + Intronic
1110194987 13:72778968-72778990 TAAATCTGTTCATCAAAGCCAGG + Intronic
1113400667 13:109989762-109989784 CAGAGCAGGTCACCAAAGCCAGG - Intergenic
1113931612 13:113971810-113971832 TACCAGTGGTCAGCAAGGCCCGG + Intergenic
1115522986 14:34251812-34251834 GACCGCTCCTCAGCAAAGCCAGG + Intronic
1118404005 14:65405687-65405709 AACTACTGGTCAGCAAAACCTGG + Intergenic
1118707397 14:68492933-68492955 TACAGCTCGTGATCAGAGCCAGG + Intronic
1118918197 14:70125918-70125940 TACAGCTATTCAGTAAAGCCAGG - Intronic
1121742243 14:96262341-96262363 CACAGCTGGTCAGTAGGGCCTGG - Intronic
1125365027 15:38904524-38904546 CAGAGCTGCTCAGCAATGCCTGG + Intergenic
1126273452 15:46848571-46848593 CACAGCTGCTCAGCTCAGCCAGG + Intergenic
1127896848 15:63308370-63308392 TACAGCCAGTCAGGCAAGCCAGG - Exonic
1129316582 15:74749009-74749031 AAGAGCTGGGTAGCAAAGCCCGG - Intronic
1129939506 15:79481894-79481916 TACAGCTGGACATCAGACCCAGG + Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1132993739 16:2811901-2811923 CACAGCTGCTCAGCTCAGCCAGG + Intergenic
1134210510 16:12272441-12272463 TGCAGCTGCTCAGCAGAGCCTGG - Intronic
1138540680 16:57685583-57685605 TACCTCTGGCCAGCAAACCCAGG - Intronic
1140484149 16:75280733-75280755 ACCAGCTGGTCAGCAGCGCCGGG + Intergenic
1141146720 16:81536089-81536111 TATGGCTGCTCTGCAAAGCCAGG - Intronic
1142671598 17:1490121-1490143 TTGAGCTGGTCATCACAGCCTGG + Intronic
1142760580 17:2039836-2039858 ACCAGCTGGTCAGCCCAGCCCGG - Intronic
1145761965 17:27430288-27430310 TGCATCTGGTCACCGAAGCCAGG + Intergenic
1146184324 17:30715221-30715243 TACAGCTGGTGAGCTAAGAATGG - Intergenic
1148601526 17:48898048-48898070 CACAGCTGGTTAGTAAAGCTGGG + Intergenic
1148676215 17:49446634-49446656 TGCAGCAGGTCAGCTGAGCCAGG + Intronic
1150728031 17:67667189-67667211 CACAGCTGGACAGCAGATCCTGG + Intronic
1151340532 17:73467987-73468009 CACAGCTGGGCAGCACAGCATGG + Intronic
1152160705 17:78666893-78666915 TACAGCTGGGCAACATGGCCTGG - Intergenic
1153408748 18:4770040-4770062 TACAGCTGGTCAGCCAGGTGTGG + Intergenic
1158591939 18:58785260-58785282 TGCAGCAGGGGAGCAAAGCCGGG - Intergenic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1161268331 19:3375420-3375442 CACAGCCGGTCAGCAGAGCTGGG - Intronic
1162460057 19:10809657-10809679 TACACTTGGACAGCACAGCCTGG + Intronic
1162974453 19:14200453-14200475 TACAGCTGGTGAGCTAAGAATGG + Intronic
1164598927 19:29548255-29548277 GACAGCTTGTCTGCAAACCCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
925910840 2:8572781-8572803 CACAGCTGGGAAGCACAGCCAGG + Intergenic
926536955 2:14124763-14124785 TACTGCAGGTCAGCAGAGCAGGG + Intergenic
928877869 2:36062214-36062236 TACAGCTGATTTGCAGAGCCTGG - Intergenic
930296632 2:49562594-49562616 TGCAGCTGTCCAGCAGAGCCAGG - Intergenic
931533795 2:63249144-63249166 CACAGCTAGTCTGCAAAGACCGG - Intronic
932811242 2:74828003-74828025 TACAGCTGGTTGGCAGAGCTTGG - Intergenic
933655584 2:84884229-84884251 GACTGCAGGTCAGCCAAGCCAGG - Intronic
934226254 2:90133665-90133687 TACAGGTGGCCAGCAAGGCACGG - Intergenic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
939855307 2:147352026-147352048 TCCAGCTGGGCAGCAGAGCCTGG + Intergenic
939950838 2:148470134-148470156 TGCAGCTGGTTAGCAGAGCAAGG - Exonic
940574470 2:155483342-155483364 TACAGAAGGTCAGCAAAGGCTGG - Intergenic
942622106 2:177856084-177856106 TAGAGCTCCTCAGCAAAGGCTGG + Intronic
944113848 2:196165870-196165892 TACAGCTGTTCAACAATGGCAGG - Intronic
945294197 2:208154709-208154731 TACAGGTGGACAGCAAGGGCTGG - Intergenic
946302620 2:218833146-218833168 TAAGCCTGATCAGCAAAGCCTGG + Intergenic
947867425 2:233408938-233408960 CACAGCTGGTCTGAAAAGCCAGG + Intronic
1170298106 20:14851835-14851857 CACATCTGGTAAGTAAAGCCAGG + Intronic
1173018692 20:39248988-39249010 CAAAGCTGGTCTGCAAACCCAGG - Intergenic
1173626946 20:44480109-44480131 AAGACCTGGTCACCAAAGCCCGG + Exonic
1176360836 21:5995534-5995556 TGCAGCTGCTCAGCTCAGCCAGG + Intergenic
1177081433 21:16643210-16643232 TACAGATGTTGAGCTAAGCCAGG - Intergenic
1179762682 21:43543016-43543038 TGCAGCTGCTCAGCTCAGCCAGG - Intronic
1181482297 22:23207955-23207977 CACAGCTGGACAGCAGACCCCGG + Intronic
1182621352 22:31620409-31620431 GACAGCTGCTCAGCAGAGCCAGG + Intronic
1183270426 22:36859088-36859110 TACAGTTGGTCAGGAAGGACAGG - Intergenic
1185115738 22:48936423-48936445 GAGAGCTGCTCAGCAAAGCCTGG - Intergenic
950687556 3:14629303-14629325 GGCACCTGGTCTGCAAAGCCTGG + Intergenic
953785396 3:45907284-45907306 CACAGCTTTTCAGGAAAGCCTGG - Intronic
958853384 3:99355524-99355546 TACAGCAGGCCAACAGAGCCTGG + Intergenic
960156575 3:114302463-114302485 TACAGCTGGGCAGCCAAGAAGGG - Intronic
961695745 3:128703184-128703206 CACTGCTGGCCAGCACAGCCAGG - Intergenic
962849850 3:139300211-139300233 TGCAGCTTGACACCAAAGCCTGG + Intronic
968749471 4:2380214-2380236 AACAGCTAGTCAGAAAACCCCGG - Intronic
969101724 4:4774631-4774653 TCCAGCTGGGCATCAAGGCCTGG + Intergenic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
970167689 4:13257077-13257099 TACAGGTGACCAGGAAAGCCAGG - Intergenic
971361271 4:25940681-25940703 TAGAGTTGGTAAGCAGAGCCAGG - Intergenic
972303629 4:37810683-37810705 TTCTGATGGTCAGCAAAGCGTGG - Intergenic
975476912 4:74834037-74834059 TACTGCTGGCTAGAAAAGCCTGG - Intergenic
982637859 4:157919667-157919689 TACAGCCCGTCACCAAAGCCTGG + Intergenic
983562801 4:169117721-169117743 TACAGCTGGCCAGACAAGTCGGG - Exonic
986342633 5:6804111-6804133 TGCAGCTGGTGGGCAAAGCTGGG + Intergenic
987147327 5:15005083-15005105 TACCACTGCTCAGGAAAGCCAGG + Intergenic
990658423 5:57984390-57984412 TACACCTGCTGAGCAAAGCCTGG + Intergenic
991981248 5:72233267-72233289 TAATGCTGGTCATTAAAGCCTGG + Intronic
992264609 5:75005983-75006005 TACAGCTGTGCAGCAAGCCCAGG + Intergenic
992567881 5:78019466-78019488 TACATCTGCTCAGCAAACCAAGG - Intronic
993235086 5:85294610-85294632 TTCACTTGGTCAGCCAAGCCAGG + Intergenic
998783811 5:145687269-145687291 GACATGTGGTCAGGAAAGCCGGG + Intronic
998877857 5:146618643-146618665 TACAGCTGGACAGGGAAGGCAGG + Intronic
999114262 5:149148710-149148732 TGGGGCTGGTCAGCAAGGCCAGG - Intronic
999281503 5:150369430-150369452 ACCAGCTGCTCATCAAAGCCAGG - Intronic
1001055181 5:168443442-168443464 TACATCTCATCAGCAAAGCTAGG + Intronic
1002644908 5:180648322-180648344 TACAGGTGGTGAGCAAAGGCAGG + Intronic
1003541187 6:7019419-7019441 CCCAGCTGATCAACAAAGCCTGG + Intergenic
1004449534 6:15732360-15732382 TACAGGTAGTCTGCAAAGCAGGG - Intergenic
1004535296 6:16494736-16494758 TACAGCTGCTCAGCACAGATTGG - Intronic
1004576974 6:16905926-16905948 TGCAGCTGGTTATCAAAACCAGG - Intergenic
1005393047 6:25353057-25353079 TACAGTTGGTGGGTAAAGCCAGG - Intronic
1006046958 6:31306819-31306841 TCCTGCTGTGCAGCAAAGCCTGG - Intronic
1006673802 6:35747458-35747480 TAGGGCTGGTCAGCAAGGCAGGG - Intronic
1007794137 6:44333973-44333995 TAGACCTGGTCAGCTAAGCCTGG - Intronic
1007805297 6:44439886-44439908 AACAGCTGGGCAGCAATGCTGGG + Intronic
1008161385 6:48080456-48080478 TACAGCTGCTCAGCAAAGAAGGG - Intergenic
1013403447 6:109820755-109820777 AACAACTGGTTAGCAAAACCAGG + Intronic
1014530497 6:122553198-122553220 TACAGGTGGTCAGGGTAGCCAGG - Intronic
1020188928 7:5979859-5979881 GACAGCTGGTGAGCAAACACAGG + Intronic
1020293988 7:6744894-6744916 GACAGCTGGTGAGCAAACACAGG - Intergenic
1020895861 7:13938709-13938731 TACAGATCATCTGCAAAGCCTGG + Intronic
1021132320 7:16926069-16926091 TACAGCTGCTCAGTAAAGTTGGG + Intergenic
1023320646 7:38994239-38994261 CTCAGTTGGTCAGGAAAGCCAGG + Intronic
1023887264 7:44368097-44368119 TACAACTGCTCAGCTTAGCCAGG - Intergenic
1024432753 7:49309179-49309201 TACAGGAGGTCAGGAAATCCTGG + Intergenic
1027434946 7:78154810-78154832 TACAGCTGGACAATAAAACCTGG + Intronic
1029292741 7:99515107-99515129 TAAAGCTGCTCAGAAAAGCCAGG + Intronic
1032773916 7:135090475-135090497 CACAGCTGCTCAGCTCAGCCAGG + Intronic
1032954196 7:136951446-136951468 TACAGCTGGTCAGCAAAGCCAGG - Intronic
1034294926 7:149963726-149963748 CATAGCTGGTCAGCAGAGCTGGG - Intergenic
1034811136 7:154133221-154133243 CATAGCTGGTCAGCAGAGCTGGG + Intronic
1035277799 7:157758427-157758449 CACAGCTGGTCAGCTCAGCCGGG + Intronic
1039403251 8:37291215-37291237 TACAGGTGGACAGTAAAGGCAGG + Intergenic
1039485112 8:37904022-37904044 TTCAGCCGGCCAGCATAGCCTGG - Intergenic
1039887496 8:41663543-41663565 CACAGCAGGTGAGCACAGCCAGG - Intronic
1040713960 8:50224725-50224747 TAATGCTGGTCAGCTATGCCTGG - Intronic
1043977964 8:86604536-86604558 TAGTGGTGGTCATCAAAGCCAGG - Intronic
1044711514 8:95063024-95063046 TACAGCTGGAAAGCAAAGTGAGG + Intronic
1045183621 8:99813664-99813686 TACAACTGTTCAGCACAGCTTGG + Intronic
1048573105 8:135671038-135671060 TCCAGCTGGTTAGCAAAGCCAGG - Intergenic
1048656276 8:136540678-136540700 TACAGAGGGTCAGCATAGCTAGG - Intergenic
1049622438 8:143604755-143604777 GACGGCAGGTCAGGAAAGCCAGG - Exonic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1052389038 9:27856427-27856449 TACAGCTGGTCAGGAGTGCTAGG - Intergenic
1056571513 9:87820793-87820815 TTCAGCTTGTCACCAAAGGCTGG + Intergenic
1056714176 9:89014530-89014552 TAAGGCTGGAGAGCAAAGCCAGG - Intronic
1056941196 9:90958140-90958162 AACACCTGGTCAGCTAAGCGGGG - Intergenic
1057525991 9:95801996-95802018 TGCAGCTGTGCAGCAAACCCAGG - Intergenic
1058630054 9:106977126-106977148 TAGAGATGGACACCAAAGCCAGG - Intronic
1195325169 X:103752563-103752585 TACAGCTAGTCAGCCAAACCTGG - Intergenic
1201326002 Y:12759374-12759396 TACAGCTAGTTAGATAAGCCTGG - Intronic