ID: 1032955774

View in Genome Browser
Species Human (GRCh38)
Location 7:136970389-136970411
Sequence TAGTATTTGAATAAATTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032955774 Original CRISPR TAGTATTTGAATAAATTGGA CGG (reversed) Intronic
903335233 1:22620135-22620157 TAAAAGTTGAATAAATTGAAAGG - Intergenic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
906902347 1:49848793-49848815 TTTTATTTGAATAAATTTAAGGG - Intronic
908547480 1:65176083-65176105 TATTCTTTGAATAAATATGAAGG + Intronic
910167269 1:84340869-84340891 TAGTATTTGAATCAGTAGGCTGG + Intronic
911006112 1:93226381-93226403 TTGCATTTGAATCAATTGGAAGG + Exonic
911018485 1:93361227-93361249 TAGTATTTGTATAAATTTGGTGG + Exonic
911382496 1:97133030-97133052 TAGTTTTTTAAAAAATTGAAAGG - Intronic
911835048 1:102608010-102608032 CAGTATAAGAATAAAATGGAAGG + Intergenic
913232922 1:116756613-116756635 TAGTATATGGACAAATTGAATGG - Intronic
914219245 1:145663744-145663766 AAGTATTTGAATACTTTGGTGGG - Intronic
914412196 1:147440653-147440675 CAGTATTTGTAAAATTTGGAAGG + Intergenic
914471828 1:147986614-147986636 AAGTATTTGAATACTTTGGTGGG - Intronic
914864511 1:151415367-151415389 TAATATTTGAAGAAATGGGCCGG + Intronic
915099625 1:153490004-153490026 TAGAACTTTAATAAATTTGAAGG - Intergenic
917172079 1:172187942-172187964 TACTATTTGAATAAAGTTAAAGG - Intronic
921468036 1:215514917-215514939 TAGTATTGCAATAAACAGGAGGG - Intergenic
921906182 1:220497650-220497672 TAGAATGTGCATAAATTGCAGGG - Intergenic
922224962 1:223638075-223638097 AAATATTTGAAAAAAATGGATGG + Intronic
924926118 1:248682786-248682808 TATTTGTTGAATAAATTGGGTGG + Intergenic
1063607307 10:7533973-7533995 TAGTATTTGACTAAACATGAGGG + Intergenic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1064906670 10:20354404-20354426 TTATATTTGAATAACTTGAAAGG - Intergenic
1065900456 10:30202527-30202549 TAGTATTTGCATTATTTGGAGGG - Intergenic
1066332351 10:34438599-34438621 TAGTCTTTCAATAAATTGAAAGG - Intronic
1066550376 10:36549228-36549250 TATTTTTTAAATAAATTGGAAGG - Intergenic
1067240793 10:44491135-44491157 TAATTTTTGTATAAATTGTAAGG - Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1068455200 10:57246327-57246349 GAGTATTCAAATAAATAGGAAGG - Intergenic
1068577938 10:58705869-58705891 GAGTATTTGAAATTATTGGAAGG + Intronic
1069131804 10:64713990-64714012 TAGTAATTTACTAAATTGTAGGG - Intergenic
1069498732 10:68930518-68930540 TATTAGTTGATGAAATTGGAAGG - Intronic
1071929298 10:90448954-90448976 CAGTAGATCAATAAATTGGAAGG + Intergenic
1072217698 10:93301890-93301912 TATGATTTGAAAAAATTGGAAGG + Intergenic
1072266261 10:93730815-93730837 TAGCATTTGAAGATATGGGAAGG - Intergenic
1072774601 10:98178231-98178253 TAGTTTTTGTATAAGTTGTAAGG + Intronic
1073744860 10:106456453-106456475 TAATAATTATATAAATTGGATGG + Intergenic
1073748010 10:106492471-106492493 TCCTATTTGAATAAAATGTAGGG - Intergenic
1078255215 11:9653027-9653049 CAGTATGTGAAAACATTGGATGG - Intergenic
1080414363 11:32055662-32055684 TAGTATTTTAATAACCTGTATGG - Intronic
1081215733 11:40395182-40395204 TAGTATTTGAATTAAATTTAAGG - Intronic
1081475817 11:43430044-43430066 TAGTTTTATAATAAATTGCATGG + Intronic
1085885231 11:80513905-80513927 TAGCATTTGAGTAAATTATAAGG + Intergenic
1085985235 11:81779058-81779080 TAGAATTCGAATGAATGGGAGGG + Intergenic
1086486815 11:87313555-87313577 TAGAAATTGGATGAATTGGATGG - Intronic
1086891152 11:92259736-92259758 TTGAATTGAAATAAATTGGAAGG + Intergenic
1087106899 11:94418643-94418665 TAGTATTTGAACAAAGCAGAAGG - Exonic
1087262665 11:96028108-96028130 TATTATTTGACTAAATTTAAGGG + Intronic
1087489529 11:98806591-98806613 TATTATTTGTATAAATTTAAAGG + Intergenic
1087659653 11:100971988-100972010 TAGTATTTGATTATATTAAAAGG + Intronic
1087857014 11:103104208-103104230 TAGTATTTGAATCAATAGACTGG - Intergenic
1087881982 11:103427289-103427311 TATTATTTCAATAAATTTCACGG + Intronic
1090099364 11:123778007-123778029 AAGTATGTGACTGAATTGGATGG - Intergenic
1091818874 12:3459555-3459577 TAGTGTTTGCATAAATTTGCAGG - Intronic
1092641377 12:10514387-10514409 AAGTATTTGAAAACATTGTAAGG - Intronic
1093237278 12:16626938-16626960 GAGTATTTGAATTCATTGCATGG + Intergenic
1093424436 12:19012070-19012092 TATTATTTGTATAAATTTAAGGG - Intergenic
1094306862 12:29029711-29029733 AAGTATAAGAATAAACTGGATGG - Intergenic
1094502425 12:31033257-31033279 TAGTGTTTGCATAAATTTGCAGG + Intergenic
1095453557 12:42357738-42357760 TTTTATTTGTATAAATTTGATGG + Intronic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1098145710 12:67495952-67495974 TTGTATTTGAATAAATTCCCAGG + Intergenic
1098315825 12:69192483-69192505 AAGAATTTGAATAAGTGGGAAGG - Intergenic
1098366934 12:69713365-69713387 TAGTATTTTCAAGAATTGGAGGG - Intergenic
1099126505 12:78765223-78765245 TAATAATTGTAAAAATTGGAAGG - Intergenic
1100801750 12:98239124-98239146 TAGAATTTGAAGGAATTTGATGG + Intergenic
1101069384 12:101058029-101058051 TAATTTTTGAATAAAGTGTAAGG + Intronic
1101822365 12:108193881-108193903 TAGTTCTTGAATAAATGGGATGG + Intronic
1102666704 12:114580398-114580420 TTGGATTTGGATAACTTGGAGGG + Intergenic
1105062011 12:133161272-133161294 TAGAATTTTAAAAAATTGGCCGG - Intronic
1107665756 13:42688631-42688653 TAGTTTCTGAATACATTGGCTGG - Intergenic
1109587145 13:64421107-64421129 TATTACTTGAAAAAACTGGATGG + Intergenic
1109753586 13:66728343-66728365 TAGTTTTTGACTAATTAGGAAGG + Intronic
1110015575 13:70397026-70397048 TAGTTTTTGAATAAATTTCAAGG - Intergenic
1110082011 13:71325690-71325712 TGTTATTTGAATAAATGGCACGG + Intergenic
1110139147 13:72105737-72105759 TTGGAGATGAATAAATTGGAAGG - Intergenic
1110326146 13:74217810-74217832 TAGCATATGAATACATTGTAAGG - Intergenic
1110658297 13:78026994-78027016 TAGTAATTGGATAAATTTTATGG + Intergenic
1110755553 13:79169728-79169750 TATTATTTGTATAAATTTAAAGG - Intergenic
1110856985 13:80307721-80307743 TATTATTTGAATAAGTTGTCTGG + Intergenic
1111621930 13:90735450-90735472 TAATTTTTGTATAAAGTGGAAGG + Intergenic
1111850615 13:93568755-93568777 TAGTATATGATTAAACTGGATGG - Intronic
1112009094 13:95279055-95279077 TAGCATTTGGTTAAATTGTAGGG - Intronic
1113136962 13:107101457-107101479 TAGTATTAGAATAATTTGTTAGG + Intergenic
1113410885 13:110088711-110088733 AACTATTTGTATAAATTTGAGGG + Intergenic
1113684043 13:112267240-112267262 TAATATTTGTATAAAGTGTAAGG - Intergenic
1115026997 14:28757575-28757597 TAGTGTTTGAATAAAAATGACGG - Intergenic
1115083228 14:29482980-29483002 TAGTATTTGCTTAAATTGAAAGG - Intergenic
1115863356 14:37713878-37713900 TAGTATATCAATAAGTTAGAGGG + Intronic
1116033722 14:39603427-39603449 GAGTATTTGTATAAATGGGTAGG - Intergenic
1116034234 14:39608752-39608774 TACTAGTTGATCAAATTGGAGGG + Intergenic
1116232623 14:42236198-42236220 TAGAACTTCAATAAATTTGAGGG + Intergenic
1117525784 14:56602251-56602273 TAGGATTTAAATAAATAGAAAGG + Intronic
1117806785 14:59501114-59501136 TACTATTTGAATTTATTTGATGG + Intronic
1118119431 14:62822147-62822169 TACCATGTTAATAAATTGGAAGG + Intronic
1118512060 14:66486205-66486227 AAGTCTTTGAATGAATAGGATGG - Intergenic
1118587570 14:67369700-67369722 TAATATATGAATTATTTGGAAGG - Intronic
1120710281 14:87786432-87786454 TAGTATTTGTATATATAAGAGGG + Intergenic
1124137149 15:27044902-27044924 CAGTATGTAAATAAATTGAAAGG - Intronic
1124797511 15:32796347-32796369 TAATTTTTAAATATATTGGAAGG - Intronic
1125064952 15:35471451-35471473 TAATAGTTGTATCAATTGGAGGG - Intronic
1125304628 15:38296530-38296552 TAGTATTTCAATAAAGTCAAAGG - Intronic
1128682246 15:69660561-69660583 TGGTATTTGATGCAATTGGATGG + Intergenic
1128823600 15:70686819-70686841 TAATACTTGAATTAAATGGAAGG + Intronic
1130127194 15:81103861-81103883 TAGTGTTGGAATGAATTGGAGGG + Intronic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1135014276 16:18911025-18911047 GACTATTTGCATAGATTGGAGGG - Intronic
1139358563 16:66382217-66382239 TAGCATCTGACAAAATTGGATGG + Intronic
1140155544 16:72421618-72421640 TAGTATTTGTATAAATAATAAGG + Intergenic
1144089078 17:11837452-11837474 TAGTTTGTTAATAGATTGGATGG - Intronic
1144315305 17:14055125-14055147 AAATATTTGAATAAAATGAAAGG - Intergenic
1145700862 17:26828902-26828924 TTGTAATTGAATAGAATGGAAGG + Intergenic
1145878489 17:28337251-28337273 TAGTATATGAATCAATTGGAGGG - Intronic
1146775279 17:35609004-35609026 TACTAATTGAATATATTGGATGG + Intronic
1148630446 17:49104145-49104167 GAGTATTGGAAGAAAATGGAAGG - Intergenic
1150814684 17:68383718-68383740 AAGTGCGTGAATAAATTGGAGGG + Intronic
1150880690 17:69023287-69023309 TAATATTTCAATACATTTGAAGG + Intronic
1153118279 18:1687617-1687639 TACAATTTGAATGAATTGCATGG - Intergenic
1153178692 18:2407975-2407997 TAACATTGGAATAAATTTGAAGG - Intergenic
1153857356 18:9163208-9163230 TAATTTTTGTATAAATTGTAAGG + Intronic
1154047366 18:10919014-10919036 ATATATTTGAATAAATTTGAGGG - Intronic
1154173945 18:12070078-12070100 ATATATTTGAATAAATTTGAGGG + Intergenic
1155236828 18:23828431-23828453 TAGTATTAGAATGAAGTAGAGGG - Intronic
1155404261 18:25470465-25470487 TAGTAAAAGAATAAATTGAAAGG - Intergenic
1156107631 18:33684874-33684896 TAGAATTTGAATAAAATGAATGG + Intronic
1156109751 18:33711635-33711657 TATCATTTGAATAAATTAGATGG + Intronic
1156599325 18:38586299-38586321 TAGAATTTAAATGAATTGAAAGG + Intergenic
1156705599 18:39877798-39877820 AAGTTTGTGAATAATTTGGAAGG - Intergenic
1156873212 18:41972905-41972927 TAAGATTTGACAAAATTGGAAGG + Intronic
1156947273 18:42850018-42850040 TAGTATATTTAAAAATTGGAGGG - Intronic
1156962682 18:43051583-43051605 TAGTATATGAAAAGATTTGAGGG - Intronic
1158097469 18:53790389-53790411 TAGTATTTTAAATAAATGGAGGG + Intergenic
1159145342 18:64447001-64447023 AAGTATTTGAAGAAAAAGGAAGG + Intergenic
1159526971 18:69604871-69604893 TTTTATTTGTATAAATTTGAGGG + Intronic
1160268852 18:77365619-77365641 TAGTCTTTGAATAAGATGAAGGG - Intergenic
1166968993 19:46549729-46549751 TATTATTTGTATAAATTTAAGGG + Intronic
926503978 2:13687907-13687929 TACAATTTGAATAAATTCCACGG + Intergenic
928790374 2:34943800-34943822 TAATATTTTAATAAATTAAATGG - Intergenic
929654230 2:43714518-43714540 TTGCATTTGAATACCTTGGAGGG + Intronic
930376541 2:50574243-50574265 TAGAAGTAGAATAAATTGGTGGG + Intronic
930495494 2:52136775-52136797 TAGTTTTTAATTAAATTGCATGG - Intergenic
930590885 2:53324512-53324534 TAGGACTTGAATACATTTGAGGG - Intergenic
931116091 2:59168421-59168443 TATTATTTGAAAAAATTTGATGG + Intergenic
933139192 2:78772849-78772871 TAGCATTTGTATATATTGGTAGG - Intergenic
933484768 2:82905928-82905950 TAACATTTTAATAAATTGCAAGG - Intergenic
935088464 2:99870821-99870843 TGGTATTTAAATCAATTTGAGGG - Intronic
937916964 2:127103978-127104000 GGGTATGAGAATAAATTGGAAGG - Intronic
939717221 2:145599464-145599486 TGGCCTTTAAATAAATTGGAAGG + Intergenic
939727171 2:145735757-145735779 TATTTTTTGAACAAATTGTAAGG + Intergenic
941312154 2:163946974-163946996 TAGTATTTGAGGAAAATTGAAGG - Intergenic
941662703 2:168211604-168211626 AAATATAAGAATAAATTGGAAGG - Intronic
941839895 2:170070224-170070246 TATTAATTGAATAAATGGGGGGG + Intronic
943007969 2:182409658-182409680 TAGCAATTGAATGAATGGGAGGG + Intronic
943046868 2:182870237-182870259 TAGTATATTAATAATTTGGTGGG - Intergenic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
943989041 2:194661875-194661897 TTGTCTTTCAATAAATTGAAGGG + Intergenic
944344611 2:198647112-198647134 TTGTATTTGAATATTTGGGAGGG + Intergenic
945597002 2:211808293-211808315 TAATTTTTGAATAAAGTGTAAGG + Intronic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
947246417 2:228053631-228053653 TAGTTTTTCAATAAATCAGAGGG - Intronic
1169352191 20:4877656-4877678 TAGAATTTAACTGAATTGGAGGG + Intronic
1170315317 20:15034880-15034902 TGCTATTTGTATAAATGGGAGGG - Intronic
1171154967 20:22863557-22863579 TTGTGTTTAAATTAATTGGATGG - Intergenic
1172252925 20:33492329-33492351 TTTTATTTGAAAAAATTGGGGGG + Intronic
1173153709 20:40589677-40589699 TCTTATTTGAAAAACTTGGAGGG + Intergenic
1175062977 20:56260416-56260438 GAGCATTTGATTTAATTGGAGGG + Intergenic
1176692108 21:9926957-9926979 TAATGGTTGAATAAATTGTATGG + Intergenic
1177531027 21:22358040-22358062 TTGTATTTGAGGAAATTGAAGGG - Intergenic
1179841210 21:44075345-44075367 AAATAGTTGAAGAAATTGGAAGG + Intronic
949512748 3:4781103-4781125 TAGTATTTGAGAGAATTGGCAGG + Intronic
950034382 3:9874663-9874685 GATTATTTGAATAAAGTGGTAGG - Intronic
950693454 3:14679316-14679338 TAGAAATTGGATAAATGGGAAGG + Intronic
951501086 3:23388654-23388676 TACTATTTAAATAAATGGAATGG - Intronic
951556339 3:23924344-23924366 TGCTATATTAATAAATTGGAAGG + Intronic
952266106 3:31787865-31787887 GAGTATTTAAATAAATTATAAGG + Intronic
952563536 3:34626250-34626272 CAGTATTAAAATAAAATGGAAGG - Intergenic
953428324 3:42814903-42814925 TAGGATGTAAATAAATTGGGAGG + Intronic
956269876 3:67440205-67440227 TAGTTTTTGCATAAAGTGTAAGG - Intronic
956982291 3:74653200-74653222 TACTCTTTGAATATTTTGGATGG + Intergenic
957161727 3:76618854-76618876 TATTATTTGAATAGATTGATAGG + Intronic
957347534 3:78981690-78981712 TTGGATTAAAATAAATTGGAAGG + Intronic
957366601 3:79232509-79232531 TAGTCTTTAAATAAGTTGAAAGG + Intronic
958065355 3:88538205-88538227 TAGTATTTTTATAAATAGGTAGG + Intergenic
959216987 3:103463752-103463774 TAATTTTTGTATAAATTGTAAGG - Intergenic
959955445 3:112232979-112233001 TAGTTTTTGACCAAATTGGGAGG - Intronic
960258658 3:115539007-115539029 TAGTATTTGAAGAAACTTTAGGG + Intergenic
960521537 3:118660816-118660838 TAGTATTTTAACAACTTGCATGG + Intergenic
961344408 3:126253843-126253865 TACTATTTGAATAAACTCTATGG + Intergenic
962038395 3:131678967-131678989 AACTATTTCAAAAAATTGGAGGG - Intronic
964523207 3:157589064-157589086 TATTATTTGTATAAATTTAAGGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964723909 3:159794777-159794799 TAGTATTGTAATAAAATGGTAGG + Intronic
964788601 3:160428184-160428206 AAGTACTTGCATAATTTGGAAGG - Intronic
967520713 3:190429127-190429149 TAGTATTTGAATGAAGGTGAGGG - Exonic
968986180 4:3875723-3875745 TAGCATTTGCATAGAATGGAGGG + Intergenic
969886336 4:10218843-10218865 TAGTAATTGATTAAACTGGGTGG - Intergenic
970558838 4:17262497-17262519 TATTATTTGTATAAATTTAAGGG + Intergenic
971643356 4:29163872-29163894 TAGACTTTGAATTAATTGAAAGG + Intergenic
971749839 4:30632854-30632876 TGTTATTTGTATAAATTCGAGGG - Intergenic
972637939 4:40900940-40900962 TAGTATTTCAAAAAACTGGAAGG + Intronic
972709707 4:41582821-41582843 CAGTATTTTTATAAGTTGGAGGG + Intronic
973046300 4:45537559-45537581 TAGTAATAGGATAAATTGGGTGG + Intergenic
974338603 4:60584937-60584959 TAATATAAGAATATATTGGAAGG + Intergenic
974648831 4:64728081-64728103 GAGAATTTGAATAGAATGGAAGG - Intergenic
975360592 4:73465951-73465973 TAGTTTTTATATAAATTGTAGGG - Intergenic
977011849 4:91645460-91645482 TATTTATTGAATAAATTGGCAGG - Intergenic
977060329 4:92251201-92251223 TAATATTTGTATAAAGTGTAAGG + Intergenic
977072768 4:92413051-92413073 TAGTATTTGTATAAATTTAAGGG + Intronic
977125173 4:93156392-93156414 TAGTGTTGGAATAGATTGGAGGG + Intronic
977309660 4:95369800-95369822 TAAAATATGAATAAATAGGAAGG + Intronic
977337810 4:95720212-95720234 TAGCATTTGAATAAAACAGATGG - Intergenic
979008183 4:115331648-115331670 TAGTATTTGGATATATTGGAAGG - Intergenic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
980305226 4:131052378-131052400 TTGTATGTGACAAAATTGGAAGG + Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981153280 4:141403582-141403604 TAGTTTCTGAATAAATGGTAGGG - Intergenic
981233791 4:142391145-142391167 TACAATTTGAATAAATTCCATGG + Intronic
981543629 4:145872000-145872022 TAGTATTTGAGCCGATTGGAAGG - Intronic
983189853 4:164743726-164743748 TAGTATTTTAATACATTTTAGGG - Intergenic
983492297 4:168401712-168401734 TAGTATTCGAAAAAATTCTATGG - Intronic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
983767033 4:171497258-171497280 TGGTTTTTGAATAAATTTGGAGG + Intergenic
983874158 4:172856920-172856942 TAGGACTTTAATAAATAGGAAGG + Intronic
984797690 4:183679531-183679553 TAGTATTTGGAGAAATAGCATGG + Intronic
985059872 4:186066909-186066931 TAGAATGTGAATAAATTTAAGGG + Intergenic
986373727 5:7108364-7108386 TAGAATATTAATAAAATGGAGGG + Intergenic
987504982 5:18756752-18756774 CAATATTTAAATAACTTGGATGG + Intergenic
988368894 5:30341253-30341275 GAGAATTTTAACAAATTGGAAGG + Intergenic
988369653 5:30349760-30349782 TAATAATTGAATACAATGGAAGG + Intergenic
988425110 5:31054957-31054979 TAGTGATTAAATAAATTGGAAGG + Intergenic
988448260 5:31312012-31312034 GAGAGTTTGAATAAATTTGAGGG - Intronic
988451203 5:31344771-31344793 TAGTGTGTGAATAAAATGAAGGG - Intergenic
990093639 5:52085614-52085636 TATTTTTTGAATAAATTGTTGGG - Intergenic
990811405 5:59728458-59728480 GAGCATTTGAATAACTTGAAAGG - Intronic
991292532 5:65046518-65046540 TAGCATTTGAATAGATGAGAGGG - Intergenic
992331968 5:75726382-75726404 TATCATTTGAACAAAATGGATGG - Intergenic
992734708 5:79707130-79707152 TAGTATTTGAATACATTTCAGGG + Intronic
995170140 5:109099649-109099671 TATTATTAAAATAAATTGCACGG + Intronic
995538705 5:113163311-113163333 AAGTTTTTGAATAAATTGTGTGG + Intronic
995711863 5:115043911-115043933 TAATTTTTGTATAAATTGTAAGG - Intergenic
996855492 5:128001532-128001554 TAGTATTTGCATTAATTTCAAGG + Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
998238747 5:140423192-140423214 TATAATTTGAATAAATAGGCTGG - Intronic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
999501902 5:152155470-152155492 TAATTTTTGAATAAAGTGTAAGG + Intergenic
999529057 5:152441781-152441803 TAGTAGTTGTATAAATTTGGTGG - Intergenic
1000585055 5:163087181-163087203 TAATTATTGAATAAATTGGGTGG - Intergenic
1000693635 5:164352801-164352823 TAGTGTGTGAATAAATTAGGGGG - Intergenic
1001414509 5:171535422-171535444 GAATATTTGAATAAATGGGAAGG + Intergenic
1001499826 5:172222036-172222058 TAGTATTTGAGTAAATGATATGG - Intronic
1003283023 6:4710611-4710633 AAGTAGCTGAATAGATTGGATGG - Intronic
1005737851 6:28765591-28765613 TAGTACTTGGATAGACTGGATGG + Intergenic
1005799170 6:29402076-29402098 TACTATTTTAATTAAATGGAAGG - Intronic
1009318853 6:62259330-62259352 TAGTATTTGAAGAAAATTTAAGG - Intronic
1009522556 6:64701822-64701844 TTTTATTTGAATAAATTTAAGGG - Intronic
1009796459 6:68475065-68475087 AAGTATTTGAAAAAAGTAGATGG - Intergenic
1010501246 6:76603027-76603049 TAATATTTGAATAAAGTGTAAGG - Intergenic
1010558375 6:77314837-77314859 TACTATTTGAATAAATAACATGG + Intergenic
1010972688 6:82279569-82279591 TAATTTTTGAATAAGTTGTAAGG + Intergenic
1012715730 6:102666943-102666965 TAGTAGTTGTATAAATTTGTGGG - Intergenic
1013027429 6:106290611-106290633 TATTATTACAATAAACTGGATGG - Intronic
1013160309 6:107537518-107537540 TAGTTTTTTAATAATTTGAAAGG + Intronic
1013321245 6:108991973-108991995 TAGGATTTGAAGAATTTGGATGG - Intronic
1013442844 6:110189119-110189141 TACTAATAGAATAAATGGGAAGG - Intronic
1013856070 6:114573808-114573830 TATTATTTGCATAAATTTAAGGG - Intergenic
1014221248 6:118800885-118800907 TAGTATTTGAGCACATTTGATGG + Intergenic
1014602529 6:123432009-123432031 CAGTAATTGAAAAAATTTGATGG + Intronic
1014871813 6:126605412-126605434 GAGGATTTGAACAGATTGGATGG - Intergenic
1015072340 6:129109907-129109929 TAGCAGTTTAATAAATTGAATGG - Intronic
1015560848 6:134513924-134513946 TATTATTTGACAAAATTTGAAGG + Intergenic
1015784505 6:136907766-136907788 AAATATTTTAATAAAGTGGAGGG + Intronic
1016201321 6:141413115-141413137 TAACATTTAAATAAATTGTATGG + Intergenic
1016437619 6:144053566-144053588 TACTATTTGATTAAATATGATGG + Intronic
1017348301 6:153409891-153409913 TACAATTTGAATAAATTCCATGG - Intergenic
1017785174 6:157750974-157750996 GAGGATGTGAAGAAATTGGAAGG + Intronic
1020548697 7:9569587-9569609 TAGGAGTTTAATAAATTGGTAGG + Intergenic
1020857745 7:13450767-13450789 TAGTAATTGGTGAAATTGGAGGG - Intergenic
1020871965 7:13642126-13642148 TAGTCTTTCAATAAATTAAATGG + Intergenic
1022321838 7:29295212-29295234 AAATATTTGAAAAAAATGGATGG - Intronic
1022334610 7:29410685-29410707 TTGTTTTTGAAGAAACTGGAGGG + Intronic
1022516313 7:30976972-30976994 TAAGAGTTGAATAGATTGGATGG - Intronic
1023652126 7:42382474-42382496 CAGAATTTGAATAAAATGGTTGG - Intergenic
1023664315 7:42505908-42505930 TAGGATTTGAATAAAGTTCAGGG - Intergenic
1024422225 7:49182180-49182202 TAGTATTTGAATACTTTTGTTGG - Intergenic
1024766151 7:52662667-52662689 AAATACTTGAATAAATTGAAAGG + Intergenic
1026177979 7:68014498-68014520 TTGTCTTTGAATAAATTCGAGGG + Intergenic
1027725320 7:81798074-81798096 TATTTTATAAATAAATTGGAGGG - Intergenic
1027934529 7:84586210-84586232 TAGTAATTGGTGAAATTGGAGGG - Intergenic
1028279764 7:88907924-88907946 GACTATTTGACTAAATTGGCTGG + Intronic
1028643334 7:93068660-93068682 TAATATTTGTATAAGGTGGAAGG + Intergenic
1029143480 7:98429001-98429023 AAGTATTTAAAAAAATAGGATGG + Intergenic
1029168167 7:98610895-98610917 TAGAATTTGAATAAAATTGGGGG + Intergenic
1029922864 7:104284361-104284383 TATAATTTGAATCAATTTGAGGG - Intergenic
1030275062 7:107711846-107711868 TAGTATGAGAATGAATTAGAGGG - Intronic
1030533011 7:110733701-110733723 TAGTATGTGATTAAATTGTAAGG + Intronic
1030825368 7:114149829-114149851 TAGTATTTCAAGAAATTAAAAGG - Intronic
1031044768 7:116875517-116875539 TAGATTTGCAATAAATTGGAGGG + Intronic
1031565715 7:123294870-123294892 TACTATGTGAATAAAATAGAGGG - Intergenic
1032637606 7:133727035-133727057 CAATATTTGAATAAATTTAATGG - Intronic
1032808004 7:135377519-135377541 TAGTATGTGAATATACTGTAAGG - Intronic
1032868408 7:135953154-135953176 TAGTATTTAAATTAATGGGAAGG - Intronic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1033266761 7:139893824-139893846 TATTAACTGAATAAATTAGATGG + Intronic
1034134462 7:148753253-148753275 TATTAATTGAATAAAATGAACGG - Intronic
1036024124 8:4883962-4883984 GAGGATTGGAAGAAATTGGAAGG - Intronic
1036236356 8:7042723-7042745 TAGTTTTTGCATAACTTGTAAGG + Intergenic
1036957237 8:13201582-13201604 TAGTACTTAAATAACTTGAATGG - Intronic
1036976829 8:13422923-13422945 TTGAATTTGAGTAAAATGGAAGG + Intronic
1037095877 8:14986480-14986502 CAGTAATTGAACAAATTAGAAGG + Intronic
1037164417 8:15809876-15809898 TAGGATTTTAAAAAATAGGAGGG - Intergenic
1037303007 8:17472629-17472651 TAGATTTTGAAGAAATTGAAGGG - Intergenic
1037404359 8:18525491-18525513 TATTTTTAGAGTAAATTGGAAGG - Intergenic
1038079117 8:24112431-24112453 TTGAATTAGAATACATTGGAAGG - Intergenic
1038118086 8:24580506-24580528 TAGGATGTGAATAAATGGGGTGG - Intergenic
1038134408 8:24769934-24769956 TACTATGTGAAAAAATTGTAAGG + Intergenic
1038201385 8:25416218-25416240 TAGCATTGGAATAACTTGGGAGG - Intronic
1038616621 8:29101574-29101596 CAGTATTTGAGTAAATGAGATGG - Intronic
1039806315 8:41002715-41002737 TTGTATTTGTATAAATTTAAGGG + Intergenic
1039905953 8:41786491-41786513 TAGCCTTTGAATAAATGGGATGG - Intronic
1040790761 8:51226592-51226614 TAGTATTTTAGTAAATTTGGGGG - Intergenic
1042023790 8:64401019-64401041 TAATTTTTGTATAAATTGTAAGG + Intergenic
1042303016 8:67306236-67306258 TACTATGTGACTAAATGGGAAGG + Intronic
1042382958 8:68139859-68139881 TATTATTTGAACAAATTGTGTGG + Intronic
1042803003 8:72741426-72741448 TATTATTTCAATAGATTTGAAGG + Intronic
1043742787 8:83835064-83835086 TATTTTTTGAACAAAATGGATGG + Intergenic
1043866632 8:85382557-85382579 TAGAAATTGGTTAAATTGGAGGG - Intronic
1043974964 8:86574201-86574223 TATCATTTGAATAAATTACAGGG + Exonic
1044022204 8:87118442-87118464 TATTATTTGAGAAAATTTGAAGG + Intronic
1044352397 8:91182350-91182372 TAATTTTTGAATAAATTTTAAGG + Intronic
1045429975 8:102104700-102104722 TAGTATTACAAGAAATGGGAAGG - Intronic
1046367400 8:113253521-113253543 TAGGAGTTGAATGAAGTGGAGGG - Intronic
1046572218 8:115980601-115980623 TAGTTTTTGTATAAAGTGTAAGG - Intergenic
1046752806 8:117942841-117942863 TACAAGTTGAATAAATTGGATGG + Intronic
1046817754 8:118603838-118603860 TAATATATGAATATATTGGAAGG + Intronic
1046823638 8:118662945-118662967 GAGTATTTGATTCAATAGGATGG + Intergenic
1047983296 8:130205955-130205977 TAGTATTTGAAACAATTTTATGG - Intronic
1048722442 8:137341530-137341552 TAGTCTCTCAACAAATTGGATGG - Intergenic
1050694773 9:8266481-8266503 TATTTTTGGAATAAATTGGCAGG + Intergenic
1052166459 9:25336266-25336288 TGGTCTTTGAATCATTTGGATGG + Intergenic
1052872210 9:33518238-33518260 TTGTATTTGTATAAATTTAAGGG + Intergenic
1053340846 9:37328353-37328375 TAGGAATTGAATAACTTGAATGG - Intronic
1053629047 9:39913049-39913071 TAATGGTTGAATAAATTGTATGG + Intergenic
1053776721 9:41550526-41550548 TAATGGTTGAATAAATTGTATGG - Intergenic
1054214840 9:62337653-62337675 TAATGGTTGAATAAATTGTATGG - Intergenic
1054365007 9:64327959-64327981 TAATGGTTGAATAAATTGTATGG + Intergenic
1054672640 9:67817696-67817718 TAATGGTTGAATAAATTGTATGG + Intergenic
1054779511 9:69153636-69153658 GATTATTCAAATAAATTGGAGGG + Intronic
1055303542 9:74905831-74905853 CAGAATTTGAATAGATTGCAAGG - Intergenic
1056085522 9:83145486-83145508 TAGTATTGAAATAAATTTTAGGG - Intergenic
1056569242 9:87801544-87801566 TAGTAGATGAAAAAAATGGAAGG - Intergenic
1057508149 9:95653728-95653750 AAGTAACTGAATAAATTAGAAGG + Intergenic
1057710910 9:97443179-97443201 TAGTATATGAGCAAATGGGATGG - Intronic
1058649746 9:107164214-107164236 TAGAGTGTGAATAATTTGGATGG - Intergenic
1059630712 9:116118848-116118870 TAATTTTTGTATAAATTGTAAGG + Intergenic
1060293167 9:122323043-122323065 TAAAATCTAAATAAATTGGAAGG + Exonic
1185932261 X:4216307-4216329 TTGTATTTGTATAAATTTAAGGG + Intergenic
1186181575 X:6978103-6978125 TAGGATTTGAACAAATTCCATGG + Intergenic
1186359504 X:8825060-8825082 TAGAATTTGAACAGATTTGAAGG - Intergenic
1187101800 X:16200410-16200432 TAGAATTAAAAGAAATTGGAAGG - Intergenic
1187164738 X:16794487-16794509 TGTAATTTGAATAAATTGAAAGG + Intronic
1188260822 X:28021559-28021581 TTTTATTTGTATAAATTTGAAGG + Intergenic
1188331267 X:28874325-28874347 TAGTATGTGAATAAAAATGATGG - Intronic
1188723118 X:33547443-33547465 TAGTTTTTGAATATAGTGTAAGG + Intergenic
1188762023 X:34044190-34044212 TATTATTTGTATAAATTTAAGGG - Intergenic
1189725704 X:43966393-43966415 TGCTATTTGAAAAAATTGAAAGG - Intronic
1191821203 X:65310970-65310992 TAATTTTTGTATAAATTGTAAGG - Intergenic
1191930789 X:66368955-66368977 TATTATTTAAAGAAATTGAAAGG - Intergenic
1192686356 X:73309765-73309787 TAATATTTGTATAAAGTGTAAGG - Intergenic
1193178726 X:78427944-78427966 GAGTATATAAATAAATTTGAGGG - Intergenic
1193195022 X:78621133-78621155 TTTTATTTGTATAAATTTGAGGG - Intergenic
1193335102 X:80278713-80278735 TAATTTTTGTATAAATTGTAAGG - Intergenic
1193460793 X:81789024-81789046 AAGTATTTGTATAATTTTGAAGG + Intergenic
1194243136 X:91476322-91476344 TAGTAATTGAATAGATGGTAGGG + Intergenic
1194847476 X:98828213-98828235 TATTATTTAAATATTTTGGAAGG - Intergenic
1195515502 X:105770810-105770832 TTGTTTTTAAATAAATTGGTTGG + Intergenic
1195775441 X:108398999-108399021 AAGTGTTTGGATAAATTGAAGGG + Intronic
1196006958 X:110846990-110847012 TTGTATTTGTATAAATTTAAGGG - Intergenic
1196013663 X:110914972-110914994 TGATATTTGAAGAAATTGCAGGG - Intergenic
1197140904 X:123116504-123116526 TAAAATCTAAATAAATTGGAAGG - Intergenic
1197309507 X:124887019-124887041 TAGTAGGTAAATAAATTGGTAGG + Intronic
1198307224 X:135395201-135395223 TAGCATTTGAATAAGTGGGCTGG + Intergenic
1198450434 X:136762216-136762238 TAACATTTAAAAAAATTGGAAGG - Intronic
1198560132 X:137840618-137840640 TAGTATTGGAAGCATTTGGAAGG + Intergenic
1199135645 X:144248102-144248124 TTATATTTGAAAAAATTGAAAGG + Intergenic
1199279477 X:145983207-145983229 TTTTTTTAGAATAAATTGGAAGG + Intergenic
1199361135 X:146920381-146920403 TAGTTTTTGAATCTATGGGAGGG + Intergenic
1199887671 X:152037457-152037479 TAGTACTAGAATAAAATGGCTGG - Intergenic
1199900904 X:152170946-152170968 TAGTATTTAAATAATTTACAAGG - Intronic
1200860796 Y:7989709-7989731 TAATATTTGAATAAATTATAAGG - Intergenic
1201016145 Y:9604107-9604129 TTGTTTTTTAATAAATTGGTGGG + Intergenic
1201062059 Y:10055066-10055088 TTGTAAATCAATAAATTGGATGG + Intergenic
1201394320 Y:13532018-13532040 TAATTTTTGAATAAAGTGTAAGG + Intergenic
1201538057 Y:15072904-15072926 TATTATTAGAATAAATTGTGTGG - Intergenic
1201541241 Y:15107288-15107310 TATTTTTTGTATAAATTGTAAGG + Intergenic