ID: 1032955915

View in Genome Browser
Species Human (GRCh38)
Location 7:136972278-136972300
Sequence TCTACCTTGAGGGAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032955910_1032955915 10 Left 1032955910 7:136972245-136972267 CCTTATTTATTTCTTAAAAGTCT 0: 1
1: 0
2: 3
3: 92
4: 923
Right 1032955915 7:136972278-136972300 TCTACCTTGAGGGAAATTTCTGG 0: 1
1: 0
2: 1
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032955915 Original CRISPR TCTACCTTGAGGGAAATTTC TGG Intronic
904102941 1:28048656-28048678 TCTACCTTGAGTAAAAATTCTGG - Intronic
908657925 1:66407294-66407316 TCTCACTTGAGGGAAATCTAAGG - Intergenic
908763951 1:67537718-67537740 TCTCCCTGGAGGCAAATTACTGG - Intergenic
908778114 1:67661381-67661403 TATACCATGAGTGAAATTACTGG + Intergenic
909272783 1:73645157-73645179 TCTAACTTTAGGCAAACTTCTGG + Intergenic
912400334 1:109385916-109385938 TCTGCCTTGATGGAACTTTATGG - Intronic
912639697 1:111333165-111333187 TCACCCTGGATGGAAATTTCAGG + Intergenic
915630352 1:157149380-157149402 TATCCATTGAGGGTAATTTCTGG + Intergenic
915852751 1:159343952-159343974 TCTTCCTTTAGGGAAATTGCAGG - Intergenic
916485413 1:165254242-165254264 TCCAACTTGGGGGAAATTTTTGG - Intronic
916763072 1:167834365-167834387 ACTGGCTTGAGGGAAACTTCGGG - Intronic
919291444 1:195638560-195638582 TCAACTTTGAGAGAAAATTCTGG - Intergenic
920152616 1:203920734-203920756 TCTACCTTGAGGTACTTTTTGGG + Intergenic
920313167 1:205060373-205060395 TCTGCCTTGTGGGAAGTTTTGGG + Intronic
920721707 1:208393526-208393548 TTTACCTTGATGGAGCTTTCTGG - Intergenic
920739558 1:208567652-208567674 TATACCCTGAAGGAAATTGCAGG + Intergenic
920769197 1:208864728-208864750 TCTGCCTGGAGGGTATTTTCTGG + Intergenic
923639139 1:235735265-235735287 TCTTCCTTTGGTGAAATTTCTGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1065308733 10:24393930-24393952 TCTCCTTTGAGGGGAATGTCAGG + Intronic
1065430281 10:25647165-25647187 TCTATCCAGAGGGAAATATCTGG - Intergenic
1067478384 10:46580398-46580420 CCCACCCTGAGGGAAATTCCAGG - Intronic
1067616354 10:47761389-47761411 CCCACCCTGAGGGAAATTCCAGG + Intergenic
1068502096 10:57852835-57852857 TCTGCCTAGAGGTAATTTTCAGG - Intergenic
1072368284 10:94737292-94737314 TCCACCTGGAGGGTAACTTCGGG - Intronic
1077821559 11:5747962-5747984 TCTATTTTGAGGAAAATATCAGG + Intronic
1082997311 11:59264284-59264306 TATTTCTAGAGGGAAATTTCCGG + Intergenic
1083090501 11:60194381-60194403 TCTTCCTTAAGGGAAATTGGGGG + Intergenic
1085258514 11:75190926-75190948 TCTACCTGCAGGGGAATTCCAGG - Intronic
1086817166 11:91386438-91386460 GCTACCATGAGAGAAATGTCAGG - Intergenic
1087922487 11:103882541-103882563 TCTACCTTAATGAAAATTTAAGG - Intergenic
1088937168 11:114414176-114414198 GCTACCTTGAGGGAACGTTTAGG - Intronic
1090541006 11:127705224-127705246 TATGCTTTGAGGGAAATTTGTGG - Intergenic
1091915171 12:4267479-4267501 TTTTCCTTGTGGCAAATTTCAGG - Intergenic
1094024604 12:25949560-25949582 TATACCTGGAGCGTAATTTCAGG - Intergenic
1095617656 12:44211477-44211499 TCTATCTAGAGGGACATTTTTGG + Intronic
1095760047 12:45821888-45821910 TCCATCTAGAGGAAAATTTCTGG + Intronic
1098400708 12:70072584-70072606 TCTAGCATGAGGGTATTTTCTGG - Intergenic
1099247744 12:80214388-80214410 TCTAGGTTGAGGGAAACCTCTGG + Intronic
1099588680 12:84556114-84556136 GCTTCCATGAGGGAGATTTCAGG + Intergenic
1100779743 12:98011326-98011348 TCTGCCTTAAGGGAAAGTTTGGG + Intergenic
1104736869 12:131140359-131140381 TCTGTGTTGAGGGAAATTTATGG + Exonic
1105994772 13:25659846-25659868 TGTGCCTTTAGGGAAATTTTTGG + Intronic
1106199685 13:27525982-27526004 TCTACCTTTAGGTAAAACTCAGG - Intergenic
1108125096 13:47233915-47233937 TGTCCCTTGAGGGTAATGTCTGG + Intergenic
1109073174 13:57795311-57795333 TATACTTTGCTGGAAATTTCAGG + Intergenic
1109709060 13:66140338-66140360 ATTACCTTGAGGGAAATTCCCGG + Intergenic
1109855291 13:68119164-68119186 TCTTCTTTGAGGAAAATTTCAGG + Intergenic
1110794755 13:79623299-79623321 GCTCCCTTGAGGGAAATTCCAGG + Intergenic
1111284182 13:86066656-86066678 GCTACCTTGAGAGAATTTCCTGG - Intergenic
1112654229 13:101432624-101432646 TCTCCCAGCAGGGAAATTTCAGG - Intergenic
1113676131 13:112209172-112209194 TTTACCTTTGGGTAAATTTCAGG + Intergenic
1120075612 14:80154437-80154459 TCTGCCTTAAGTGAAAGTTCAGG - Intergenic
1120167174 14:81213750-81213772 TTTACCTTGAGAAAAATTACAGG - Intronic
1202850666 14_GL000225v1_random:16219-16241 TCTGCCTGGAGAGAGATTTCTGG - Intergenic
1126688128 15:51266004-51266026 CCAACCTTGAGGGAAATGGCTGG + Intronic
1132246487 15:100300213-100300235 TCTATCTTGAGGGACATCTGGGG - Intronic
1134299917 16:12981536-12981558 TCAACCTTGAAGGAATTTCCAGG - Intronic
1134449875 16:14356757-14356779 TATAGCTTGATGGAATTTTCGGG + Intergenic
1140950676 16:79814219-79814241 GCTACCTTGCTGGAAACTTCAGG + Intergenic
1144265294 17:13562690-13562712 TCTACATTGATGGAAATCACGGG + Intronic
1153178388 18:2405229-2405251 TTTAACTTGAGGGTGATTTCTGG - Intergenic
1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG + Intergenic
1155166518 18:23236578-23236600 TCTACTCTCAGGGAAATTCCAGG + Intronic
1158086704 18:53659842-53659864 TCTATCTTGAGGGGAATCTTAGG + Intergenic
1158290836 18:55940435-55940457 TCTACCCTGGAGGAAATTTAGGG + Intergenic
1159215323 18:65384412-65384434 GTTACCTTGAGTGAAATTGCTGG - Intergenic
1162462940 19:10824077-10824099 GCTTCCGTGAGGGAACTTTCTGG - Intronic
1165332812 19:35150790-35150812 TCTACCTTGAGGGCAATGGGCGG + Intronic
1165968599 19:39605591-39605613 TCTACTTTGGGGGAAATGTCAGG - Intronic
1167879771 19:52446443-52446465 TCTAGAGTGAGTGAAATTTCAGG - Intronic
1168029264 19:53666695-53666717 TCAGCCTTGAGGGCACTTTCTGG + Intergenic
1168029600 19:53669179-53669201 TCAGCCTTGAGGGCACTTTCTGG + Intergenic
926326737 2:11791282-11791304 TCTATCTTGAGGTTAATTCCAGG - Intronic
927932921 2:27057109-27057131 TCTACCTTGGGGGGACTCTCTGG + Intronic
928658269 2:33475350-33475372 TCTATATGGAGGGAAATTTCTGG + Intronic
928830054 2:35470926-35470948 CCTACGTTGAGAGAAATGTCAGG - Intergenic
928993733 2:37263945-37263967 AAAACCTAGAGGGAAATTTCTGG - Intronic
930316216 2:49799978-49800000 TCTAAATTGTGGGAAATTGCTGG - Intergenic
933004194 2:76969463-76969485 TCTAACTTTAGAGAAATTTTAGG + Intronic
934879786 2:97965861-97965883 TCTACCTTTATGTGAATTTCAGG - Intronic
936590352 2:113797808-113797830 TCTATCTTGTGGGAATTTTCTGG - Intergenic
938625754 2:133107171-133107193 TCTACCCTGAGGGACTTTGCAGG - Intronic
938646211 2:133332962-133332984 TCTCTCTGGAGGGAAAATTCTGG + Intronic
939668289 2:144977656-144977678 GCAACCTTGTGGGAAATCTCAGG + Intergenic
939879862 2:147618284-147618306 CCTACTTTGATGCAAATTTCAGG - Intergenic
940835616 2:158518006-158518028 TCTATCTTGATGGTTATTTCAGG + Intronic
943148690 2:184081041-184081063 TCTATATTGAGAGAAAATTCTGG + Intergenic
946113866 2:217444913-217444935 ACTTCCTGGAGAGAAATTTCAGG - Intronic
947581953 2:231325798-231325820 ATTACCTTTAAGGAAATTTCAGG + Intronic
949071747 2:242029344-242029366 TTTCTCTTGGGGGAAATTTCAGG - Intergenic
1169759855 20:9079438-9079460 TCTCCCTGGAGGGATATTACAGG - Intronic
1173156125 20:40610977-40610999 TCTACTGTGAGTGAAATTGCTGG - Intergenic
1174675921 20:52355520-52355542 ACTACCTTGAGAGAAGTTCCAGG - Intergenic
1177027121 21:15933733-15933755 TCTGTCTTGAATGAAATTTCTGG - Intergenic
1177190210 21:17842991-17843013 AATACCTAGAGTGAAATTTCTGG + Intergenic
1177917649 21:27110262-27110284 CCTACCATGAATGAAATTTCAGG + Intergenic
1180885680 22:19241568-19241590 TCTGCCTTGGGGAATATTTCGGG + Intronic
1203244651 22_KI270733v1_random:53818-53840 TCTACCTTGAGGTACTTTTTGGG - Intergenic
950951813 3:17008500-17008522 GCTACCTTGATGTAAATTCCTGG + Intronic
951036007 3:17932756-17932778 CCTACATTGAGGGAAATTTGGGG - Intronic
955513358 3:59703640-59703662 AATCTCTTGAGGGAAATTTCAGG - Intergenic
955717170 3:61842417-61842439 TCTTCCTAAAGGGACATTTCTGG - Intronic
959373346 3:105557439-105557461 TCTTCCTTGTGGAAACTTTCAGG - Intronic
959416900 3:106086855-106086877 TCTTCCTTAGGAGAAATTTCTGG + Intergenic
960188203 3:114670472-114670494 TCTACCTTAAGGGAAGTTCTAGG + Intronic
961180499 3:124872662-124872684 CCTCTCTTGAAGGAAATTTCTGG - Intronic
962988435 3:140557236-140557258 TCTACCTTCCAGGAATTTTCTGG - Intronic
963448934 3:145452363-145452385 TCAACATTGAGGGAAATGCCAGG - Intergenic
963700774 3:148623398-148623420 TATACCTAGAGTGAAATTTTTGG - Intergenic
964066002 3:152580200-152580222 TTGACATTGAGGGAAATTTCAGG + Intergenic
968298563 3:197595823-197595845 TCTTCCACGAGGGAACTTTCGGG - Intergenic
970178495 4:13363298-13363320 TCTACCCTCAGGGAGATTTGGGG - Intronic
974965500 4:68756030-68756052 TCTACTTTGATGGAAATTTCTGG - Intergenic
974985642 4:69023007-69023029 TCTACTTTGATGTAAATTTCTGG - Intronic
975000276 4:69217256-69217278 TCTACTTTGATGTAAATTTCTGG - Intergenic
975005489 4:69277950-69277972 TCTACTTTGATGTAAATTTCTGG + Intergenic
975013904 4:69386937-69386959 TCTACTTCGATGTAAATTTCTGG + Intronic
975015163 4:69406288-69406310 TCTACTTTGATGTAAATTTCTGG + Intronic
977429338 4:96911827-96911849 TTTACATGGAAGGAAATTTCAGG + Intergenic
978670196 4:111238945-111238967 TCTAGCTAGAGGCAAATGTCAGG - Intergenic
979354235 4:119684131-119684153 TCTACCTTGGGTGAGGTTTCAGG + Intergenic
979993129 4:127399605-127399627 TCTACTTTGAGGAAAAATCCAGG - Intergenic
981047775 4:140281314-140281336 TCTACCTGGAGGGACACATCAGG + Intronic
981689005 4:147485664-147485686 TCCATCTTGAGGCAAATTTGAGG - Exonic
982463255 4:155697815-155697837 TCCACCTTGAAGGAAACTTCTGG + Intronic
984606450 4:181790826-181790848 TCTTCCTCAATGGAAATTTCTGG + Intergenic
986252997 5:6078213-6078235 TGTACCTGGAGTGAAATTGCAGG - Intergenic
990323506 5:54651965-54651987 TCTACCTTGAGGAAAATATATGG + Intergenic
992719152 5:79542677-79542699 TTTAACATGAGAGAAATTTCTGG - Intergenic
995752232 5:115464537-115464559 ACTACCTTAATTGAAATTTCAGG - Intergenic
998138598 5:139687603-139687625 GCTACCTTGAGAGAAAAATCAGG + Intergenic
1003933849 6:10955443-10955465 TCTTCCTTCTGGGAATTTTCAGG + Intronic
1006259754 6:32857988-32858010 TCTATCCTGAGGGAAATATTAGG - Exonic
1006336339 6:33422793-33422815 TCATCCTTTAGGGAAAGTTCTGG - Intronic
1007194746 6:40050933-40050955 TCTACCTTAAGTGGAATTCCTGG - Intergenic
1009287183 6:61834187-61834209 TCTACCCTGAGAGAATTTTTTGG - Intronic
1009520909 6:64681295-64681317 TATTGCTTGAGGGTAATTTCTGG + Intronic
1013469356 6:110448007-110448029 TATACCTAGAGTGAAATTCCTGG + Intronic
1014726788 6:124980804-124980826 TGTAATTAGAGGGAAATTTCAGG - Intronic
1015828341 6:137340337-137340359 TCTATCTTGTCGGAAATTTTTGG + Intergenic
1016133342 6:140505777-140505799 TCTACCTTTAGATAATTTTCAGG - Intergenic
1016302163 6:142644758-142644780 TCTCCCCTGATGGAAATTTGTGG + Intergenic
1016713271 6:147197219-147197241 TCCACTTTGGGGTAAATTTCTGG - Intergenic
1018123853 6:160662959-160662981 TGTCCCTTGAGGCAAATCTCTGG - Intronic
1018209847 6:161470386-161470408 TCTACCTAGAGGAAAACCTCAGG - Intronic
1020861021 7:13491815-13491837 TCTATCTTGAAGAAAGTTTCAGG - Intergenic
1022953744 7:35362934-35362956 TCTGCTCTGAGGTAAATTTCTGG - Intergenic
1023574366 7:41610019-41610041 TATACCATGAGGTATATTTCTGG + Intergenic
1023595157 7:41821926-41821948 TCTACTTAGAAGGGAATTTCAGG + Intergenic
1032955915 7:136972278-136972300 TCTACCTTGAGGGAAATTTCTGG + Intronic
1033781771 7:144679545-144679567 TCAATCATGAGGGAATTTTCTGG + Intronic
1035965090 8:4182589-4182611 TCTACTCTGAGGGAATTTTATGG + Intronic
1037004454 8:13759848-13759870 TCTCACTTCAGGGAAATTTCAGG + Intergenic
1045605882 8:103774757-103774779 TTTTCCTTGAGGGAACTTTCTGG + Intronic
1049652278 8:143776533-143776555 ACCACCTTGAGAGAATTTTCAGG + Intergenic
1049699537 8:144003567-144003589 TCTGCCTAGAGGCACATTTCAGG + Intronic
1050298684 9:4234058-4234080 TTTAGCTTGAGGGAATTTTGTGG + Intronic
1050340913 9:4637629-4637651 TCTACCGTTAGTGATATTTCAGG - Intronic
1050354854 9:4773091-4773113 TCTCCCTGAAGGGAAAATTCAGG + Intergenic
1052374178 9:27699014-27699036 ACTACCTTGAAAGTAATTTCAGG - Intergenic
1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG + Intergenic
1055763501 9:79635962-79635984 TCAACCTTGAGAGAAATGTTAGG - Intronic
1187946254 X:24428746-24428768 TTTACTTGGAAGGAAATTTCAGG - Intergenic
1188767170 X:34108442-34108464 TCTACCAAGAGGGAAATGTATGG - Intergenic
1188971163 X:36617097-36617119 GCTACTATGGGGGAAATTTCAGG + Intergenic
1190043579 X:47093004-47093026 TCTAACTAGATTGAAATTTCAGG - Exonic
1190216960 X:48485979-48486001 CCTGCCTTTAGGGAAAATTCTGG - Exonic
1190787352 X:53664351-53664373 TCTTCCTTAAGGAAAATTTTAGG - Intronic
1193464738 X:81834472-81834494 TTTGGCTTGAGGCAAATTTCTGG + Intergenic
1199354852 X:146850117-146850139 CCTACCTTGACAGAATTTTCAGG - Intergenic
1202180637 Y:22136895-22136917 TCTAATTTGAGGTAAATTCCAGG + Intergenic
1202210723 Y:22449504-22449526 TCTAATTTGAGGTAAATTCCAGG - Intergenic