ID: 1032962040

View in Genome Browser
Species Human (GRCh38)
Location 7:137046859-137046881
Sequence CAGAAGAAGGAGGAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032962032_1032962040 4 Left 1032962032 7:137046832-137046854 CCTACATAAGAATGACCTCATTA No data
Right 1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032962040 Original CRISPR CAGAAGAAGGAGGAGGGGGA AGG Intergenic
No off target data available for this crispr