ID: 1032967878

View in Genome Browser
Species Human (GRCh38)
Location 7:137122244-137122266
Sequence CCAGCTTTTTCCCCGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032967878_1032967883 14 Left 1032967878 7:137122244-137122266 CCTGCTTGCGGGGAAAAAGCTGG No data
Right 1032967883 7:137122281-137122303 CCTACAGCTTTTAACAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032967878 Original CRISPR CCAGCTTTTTCCCCGCAAGC AGG (reversed) Intergenic
No off target data available for this crispr