ID: 1032968229

View in Genome Browser
Species Human (GRCh38)
Location 7:137127740-137127762
Sequence CAGAGCTATAATCTTGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032968224_1032968229 12 Left 1032968224 7:137127705-137127727 CCACATGGTATCACATAGTGTGC No data
Right 1032968229 7:137127740-137127762 CAGAGCTATAATCTTGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032968229 Original CRISPR CAGAGCTATAATCTTGGAGC GGG Intergenic
No off target data available for this crispr