ID: 1032977485

View in Genome Browser
Species Human (GRCh38)
Location 7:137242148-137242170
Sequence GATTATTAAATGGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 13, 3: 89, 4: 771}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032977485 Original CRISPR GATTATTAAATGGGAAAAAA GGG (reversed) Intronic
901461440 1:9394259-9394281 GTCTATTGCATGGGAAAAAATGG - Intergenic
902422678 1:16293784-16293806 TATTTTTAAATGGGCTAAAAAGG - Intronic
902831907 1:19020488-19020510 GATTAAGAAATGGGCAAAACTGG + Intergenic
904138900 1:28336288-28336310 GATAGATGAATGGGAAAAAAGGG - Intergenic
904996700 1:34636790-34636812 AATTAATAAATGGGAAAGTAAGG + Intergenic
905467604 1:38167133-38167155 GATAATTAAAGGTGAAAAGATGG - Intergenic
905727726 1:40268632-40268654 GAGTATGAATTGAGAAAAAAGGG + Intronic
905838764 1:41155179-41155201 TATTATTAAAAAAGAAAAAAAGG + Intronic
905949213 1:41933418-41933440 GATTATTATCTGGGATAAAAAGG - Intronic
906626762 1:47332000-47332022 GACTTATAAATGGGAAAAGAAGG + Intergenic
906772575 1:48498473-48498495 GATTATTTAATTCTAAAAAAAGG - Intergenic
906972046 1:50525722-50525744 CACAATTAAATAGGAAAAAAAGG - Intronic
907014778 1:51001715-51001737 AGTTTTTAAATGGGAAAGAAAGG - Intergenic
907415445 1:54311105-54311127 GATTCTTTGATGGGAAAACAAGG + Intronic
907850207 1:58248854-58248876 GGTTATTAAATGGGTGCAAAAGG - Intronic
907958881 1:59259706-59259728 GATTATTAAATGAAACAAAGTGG + Intergenic
908066492 1:60411554-60411576 GTTTAACAAGTGGGAAAAAATGG + Intergenic
908212849 1:61919208-61919230 GATTATTAAGGGGTGAAAAAGGG - Intronic
909226043 1:73024078-73024100 CAATATTTTATGGGAAAAAATGG - Intergenic
909281787 1:73765084-73765106 ATTGATTAAATGGAAAAAAATGG - Intergenic
909366997 1:74836313-74836335 GTCTATAAAATGGAAAAAAATGG - Intergenic
909650303 1:77967999-77968021 GATTGTAAAATAGGAGAAAAAGG + Intronic
909682469 1:78307956-78307978 GATTAATAAAAGGGTAAAAATGG + Intronic
909692706 1:78427335-78427357 GAGAATTAAATGAGATAAAATGG + Intronic
909711013 1:78648861-78648883 GAGTATTAAGTGAGAAAAAGAGG - Intergenic
910004037 1:82373243-82373265 TATCCCTAAATGGGAAAAAATGG - Intergenic
910557361 1:88550423-88550445 TATAATCTAATGGGAAAAAATGG + Intergenic
910797430 1:91113018-91113040 GATTTTAAAATGGGCAAAATAGG + Intergenic
911211857 1:95148532-95148554 GATTTCTAAATGGCAAGAAATGG + Intronic
911709934 1:101059710-101059732 GTTTTTTAAAAGAGAAAAAAGGG - Intergenic
912026843 1:105186797-105186819 AATTATTAAATGTGTAAAAAAGG - Intergenic
912596592 1:110884761-110884783 CACTAATAAAAGGGAAAAAAAGG - Intronic
912663221 1:111553780-111553802 GTTGACTAAATAGGAAAAAAGGG - Intronic
912992131 1:114498656-114498678 AATTAATAAATTGGATAAAAGGG + Intronic
913098733 1:115543635-115543657 GATTACTAAAAAGGGAAAAATGG + Intergenic
913535328 1:119766746-119766768 GATTTCTAACTGGGAAGAAAGGG - Intronic
916179546 1:162071500-162071522 GGTTATTCAGGGGGAAAAAAAGG - Intronic
916256655 1:162794742-162794764 TATTATTAACTGGGAAATGAAGG - Intronic
917113232 1:171574377-171574399 GTTTCTTAAATGGCAGAAAATGG - Intronic
917188572 1:172388964-172388986 GATTTTTAAATGGCATAACAGGG - Intronic
917594951 1:176519783-176519805 GAATATTAAAAAGGAAAAAATGG - Intronic
918455441 1:184707246-184707268 GTTTTTGAAAGGGGAAAAAATGG + Intronic
918475111 1:184916517-184916539 AATTATTCAAGGGGAATAAAGGG - Intronic
918480495 1:184973116-184973138 GTTTGTTAAAGGGGAAAAGACGG - Intronic
918483799 1:185007573-185007595 GCTTAGTAAATGGGAAAAAAAGG + Intergenic
918527073 1:185476574-185476596 GATTACTATGTGGAAAAAAAAGG + Intergenic
918596276 1:186297697-186297719 GCTTATCAAAGGGGAACAAAAGG - Intronic
918895696 1:190341671-190341693 GACTATAAGATGGGAAAAAGAGG + Intronic
919826210 1:201505438-201505460 GCTAATAAAATGGGAAAAACAGG - Intronic
920533289 1:206720883-206720905 GAATATTAAATGGGGAAATGTGG - Intronic
920582232 1:207121375-207121397 GATTATTAAATGACACACAATGG - Intronic
920816405 1:209337362-209337384 GATTATCCAATAGTAAAAAAGGG - Intergenic
921271194 1:213471696-213471718 TGTTTTTAAATGGGGAAAAATGG - Intergenic
921335497 1:214081478-214081500 GATTATTAAAAAGTAAAATAAGG - Intergenic
921447269 1:215261421-215261443 GATTATAAAATTGGAAGAAGCGG - Intergenic
922030858 1:221796344-221796366 CATTATTAACTGGAGAAAAATGG + Intergenic
922402252 1:225272145-225272167 GATTGTTAGAAGGGGAAAAAAGG + Intronic
923833713 1:237586353-237586375 GAATTTTAAATGGTACAAAAAGG - Intronic
924094394 1:240536321-240536343 GATAATTAAATGGGAAGAAAGGG + Intronic
924378708 1:243440303-243440325 CATTATTAAATTAAAAAAAAAGG + Intronic
924411125 1:243807027-243807049 GATTTATAAATGAGAAAAATAGG + Intronic
924664732 1:246059490-246059512 GATAATAAAATAGGAGAAAAAGG - Intronic
924849071 1:247806239-247806261 GATTAAAAAATGGGAAAGGATGG - Intergenic
924934969 1:248760253-248760275 AATTATTATATGAGAAAACATGG - Intergenic
1063179271 10:3582968-3582990 TATTATGAAAGGGGAAAGAAAGG - Intergenic
1063732140 10:8709948-8709970 GATGAACAGATGGGAAAAAAAGG - Intergenic
1064468253 10:15607600-15607622 GATGGTTAAATGGAGAAAAATGG + Intronic
1064820486 10:19324819-19324841 GGTTATATAATAGGAAAAAAGGG - Intronic
1066024152 10:31336332-31336354 GTTAATTAAATGGAAAAAATTGG + Intronic
1066332988 10:34445221-34445243 CATAATTAAATGGGAATAATTGG + Intronic
1066723116 10:38360399-38360421 TATTATTAACTGGGAAATGAAGG - Intergenic
1066744479 10:38592937-38592959 AATTATCAAATGGAATAAAATGG + Intergenic
1066749166 10:38635326-38635348 CATAATTAAAAGGGAAAAAACGG + Intergenic
1066967493 10:42282465-42282487 CATAATTAAAAGGGAAATAACGG - Intergenic
1068038593 10:51793026-51793048 CATTATTAAGTGAAAAAAAAAGG + Intronic
1068075789 10:52251544-52251566 GATTTTTTGATGTGAAAAAATGG - Intronic
1068452206 10:57206323-57206345 AATTATTAAATAACAAAAAATGG + Intergenic
1069083804 10:64116334-64116356 GATTTTTAAATTCAAAAAAAGGG + Intergenic
1069528433 10:69195695-69195717 TATTAGTAATAGGGAAAAAAAGG - Intronic
1070676168 10:78413034-78413056 GAGTATGATATGGGACAAAAGGG + Intergenic
1070931277 10:80262428-80262450 CATTATTAAATGGAGAAAAACGG + Intergenic
1071903734 10:90149313-90149335 AATTATTAAAAGGAAAGAAATGG + Intergenic
1073754105 10:106562485-106562507 TATTTTTAAATGAAAAAAAAGGG - Intergenic
1073790455 10:106934826-106934848 GCTTATTAAATGAGAACATATGG - Intronic
1074003982 10:109400465-109400487 GATCATTAAAAGAAAAAAAATGG + Intergenic
1074073271 10:110095550-110095572 GAATATTACATGGCAATAAAAGG - Intronic
1074321044 10:112402681-112402703 GACTAAGAGATGGGAAAAAAAGG - Intronic
1074578663 10:114695338-114695360 GAGTATTAAATGAGAACATATGG - Intergenic
1074804564 10:117035649-117035671 GATTTAAAAATGGGCAAAAATGG + Intronic
1075121134 10:119665888-119665910 TTTTATTAAATGGCAAAAATGGG + Intronic
1077723877 11:4654084-4654106 GAAAATTAAATAGGAAAAACAGG - Exonic
1077777091 11:5283947-5283969 GATTATTAAATATCATAAAATGG + Intronic
1078284634 11:9939600-9939622 GTTTGTTATATGGGCAAAAAAGG - Intronic
1079047712 11:17122022-17122044 GATTATTAAAAAAAAAAAAAAGG + Intronic
1079504406 11:21137330-21137352 GATTATAAAATGGAAATAAGAGG + Intronic
1079603888 11:22342474-22342496 TATTATTTAAAGGGGAAAAAGGG + Intronic
1079689216 11:23401166-23401188 TATTTTTAAAAGGCAAAAAAAGG + Intergenic
1079692596 11:23438545-23438567 GAGTATTAAATGGTACAAAAAGG + Intergenic
1081148911 11:39602394-39602416 CATTATTAAATGAGCATAAATGG - Intergenic
1081158900 11:39729277-39729299 ATTTATTAAATAGGAAAAAAAGG - Intergenic
1082730177 11:56786367-56786389 GATCATCTAAGGGGAAAAAATGG - Intergenic
1082984967 11:59160661-59160683 GATTCTTAAAGGTGAGAAAAGGG + Intergenic
1083542207 11:63519991-63520013 GAATATCCAATTGGAAAAAAAGG + Intergenic
1083785125 11:64940533-64940555 GATTATTAAAGGAGAATAAATGG + Intronic
1085427442 11:76417162-76417184 GAGCGTTAAATGGGAAGAAATGG + Intergenic
1085543259 11:77292608-77292630 GATAATTAAATAGAAAAAATAGG + Intronic
1085593482 11:77787361-77787383 CATTATTAAATGGCTGAAAAAGG + Intronic
1085992008 11:81859950-81859972 TCATATTAAATGGGAAAAAATGG - Intergenic
1086187971 11:84042193-84042215 TTTGATTAAGTGGGAAAAAATGG - Intronic
1086371679 11:86161737-86161759 GATGATTAAATGAGAAAAAAAGG + Intergenic
1086430288 11:86730784-86730806 GTTTTCTAAATGGGAAACAAGGG - Intergenic
1086653530 11:89321288-89321310 GTTTATTATAAGAGAAAAAAAGG - Intergenic
1086760115 11:90619255-90619277 CATTGCTAAATGTGAAAAAAGGG + Intergenic
1087140169 11:94757344-94757366 GCTTATGAAATGAGGAAAAACGG + Intronic
1087491944 11:98838862-98838884 GATTTTAAAATGGGCAAAAGAGG - Intergenic
1087607426 11:100393762-100393784 GATAACTAAATGGGAACAATTGG + Intergenic
1087969039 11:104456320-104456342 GATTTTAAAATGGAATAAAAAGG + Intergenic
1087971007 11:104484068-104484090 TATTATTAAGTGAGAAAAAAAGG - Intergenic
1088145890 11:106677219-106677241 GATAATTCAATGGAAAAAAGAGG + Intronic
1088331726 11:108661384-108661406 GATCATTTGATTGGAAAAAATGG + Intergenic
1088689679 11:112315126-112315148 GAATATTTAACGGGAATAAATGG + Intergenic
1090533605 11:127616552-127616574 TATTTTTTAATGGGAAAAAATGG + Intergenic
1090624597 11:128595084-128595106 GATGAGTGAATGGGTAAAAATGG + Intergenic
1091419233 12:320800-320822 GAATTTTAAATGGGGAATAATGG + Intronic
1092632221 12:10394352-10394374 CAGTATTAAATGTGAGAAAATGG + Intronic
1092729730 12:11518760-11518782 CATTTTTAAATGGGTAAATATGG - Intergenic
1092773802 12:11923401-11923423 GATTATTAAGTTGGTAAAAGGGG - Intergenic
1093016003 12:14155417-14155439 TATTATTAAAAGTCAAAAAATGG + Intergenic
1093507935 12:19890998-19891020 GACTATAATCTGGGAAAAAATGG + Intergenic
1093734910 12:22609760-22609782 AAATATACAATGGGAAAAAAAGG + Intergenic
1094143360 12:27203727-27203749 CATTATTAAATGGGAGAAGAAGG + Intergenic
1094226277 12:28049652-28049674 TATTGTTGATTGGGAAAAAAGGG - Intergenic
1094234027 12:28142664-28142686 GATTATTAAAAGTGAAAATTAGG - Intronic
1094388399 12:29920712-29920734 GATTATTATTTGGTAATAAAAGG - Intergenic
1094610281 12:31989092-31989114 GTTCATTAAATGGGCAAAGAGGG + Intronic
1095249375 12:39960707-39960729 GTTTATTAAATGGTGAAAAATGG + Intronic
1095309171 12:40676616-40676638 AAGTATTAAATGAGAAAAATGGG - Intergenic
1095354073 12:41250582-41250604 CATTATTAACTGGAGAAAAATGG + Intronic
1095525858 12:43124379-43124401 GATTTATGAATGGGGAAAAAGGG + Intergenic
1095935109 12:47671054-47671076 TTTTATTAAATTGGAAAAAAGGG - Intronic
1095976639 12:47944489-47944511 GCTTATTAAGTGGGGAAAAAAGG + Intergenic
1096700315 12:53379011-53379033 TACTATTAAGGGGGAAAAAATGG + Intergenic
1096706090 12:53423389-53423411 GATTCTTAAGTTGGAAAACAAGG + Intergenic
1097502635 12:60424948-60424970 GATTATCATATGGGAGAAAGAGG + Intergenic
1097631409 12:62067938-62067960 AATTATTAAAAGGAAAGAAAAGG - Intronic
1097682764 12:62664271-62664293 GTTTATTAAATTAGAAAAAAAGG + Intronic
1098030199 12:66245854-66245876 GATTAATAAATTTAAAAAAATGG - Intronic
1098476507 12:70910251-70910273 GCTTTTTAAATGGGAGAAGATGG + Intronic
1098838814 12:75454005-75454027 GATTTTTAAAGGCAAAAAAATGG - Intergenic
1099091348 12:78313656-78313678 ATTTAGTATATGGGAAAAAATGG - Intergenic
1099213197 12:79819261-79819283 GATTATAAAATGAGAAAAATCGG - Intronic
1099315102 12:81074489-81074511 GATTGTAAAGTGGGAAAAATTGG + Intronic
1099516545 12:83603488-83603510 GATTATTAACTGGGCAAAAATGG + Intergenic
1099586825 12:84528566-84528588 GATTAATATATGTGAAAAAATGG + Intergenic
1100126869 12:91437569-91437591 GACTATCAAACTGGAAAAAAAGG + Intergenic
1100187045 12:92149937-92149959 GAGAATTAAATGGGAAAGCATGG - Intergenic
1100191730 12:92200274-92200296 GATAATGGAATGGGAAACAAAGG + Intergenic
1100288505 12:93190622-93190644 GATAATTAATTGTGAAAAATTGG - Intergenic
1101004209 12:100385687-100385709 TATTGTGAAATGGGAATAAAAGG + Intronic
1101114730 12:101520975-101520997 GCTTATAAAATTGGTAAAAATGG - Intergenic
1101485685 12:105156106-105156128 GATTATAAAATGTGAGAGAAAGG + Intronic
1102449691 12:113032002-113032024 GACTATTCAATGGGAAAGAATGG + Intergenic
1102806883 12:115789670-115789692 TATCAATAAAAGGGAAAAAAGGG - Intergenic
1103033445 12:117636966-117636988 GGTAATTTAATAGGAAAAAATGG + Intronic
1103634984 12:122297049-122297071 GATATGTAAAGGGGAAAAAAGGG + Intronic
1103840186 12:123857364-123857386 GATTTAAAAATGGGGAAAAATGG - Intronic
1104437967 12:128771019-128771041 GATTTTTAAAAAGGGAAAAAAGG + Intergenic
1104614133 12:130254344-130254366 GGATATTAAAGGGGAAAAAAAGG + Intergenic
1105385085 13:19922222-19922244 GATTTTTAAAGGGGGAAAAAGGG + Intergenic
1105497153 13:20940469-20940491 GATTATTAGAAGGTAAAAATGGG - Intergenic
1105536756 13:21273104-21273126 CATTATAAAATGGCAAAATATGG + Intergenic
1105724187 13:23144808-23144830 GATTATGAAATTTGAGAAAAAGG + Intergenic
1105911846 13:24876084-24876106 CATTATTAACTGGACAAAAATGG - Intronic
1106169722 13:27278719-27278741 GATTTATAACTGGGAAAACAAGG + Intergenic
1106299661 13:28452162-28452184 CATTATAAAATGGGAGAGAAGGG - Intronic
1106460456 13:29963632-29963654 GATGGTAAAATGAGAAAAAATGG + Intergenic
1106657109 13:31758185-31758207 GAAAATTAAATGGGACAACACGG + Intronic
1106700880 13:32227481-32227503 GATTATTAAATAGGGGAAAAGGG + Intronic
1107072535 13:36286631-36286653 GATGATGAAGTTGGAAAAAAGGG - Intronic
1107230342 13:38102080-38102102 CACTATAAAATGGGAAAATAGGG + Intergenic
1107893689 13:44937199-44937221 GATAATCAAAGGGGAAAACAAGG + Intergenic
1107902364 13:45030112-45030134 GATTATTAAATTTTTAAAAAAGG - Intronic
1108005024 13:45937779-45937801 TAATATTAAATGGGAGAATATGG + Intergenic
1108094339 13:46884738-46884760 GATGATTAAATTAGAAAGAATGG - Intronic
1109225960 13:59695866-59695888 TATTATTAAATTAGAAGAAAGGG - Intronic
1109667759 13:65561037-65561059 GATTATTAAATTTTAAAATAAGG - Intergenic
1109671482 13:65614149-65614171 AATGATAAAAAGGGAAAAAATGG - Intergenic
1109852476 13:68084836-68084858 GATTATTATATGGTAACAGAGGG - Intergenic
1109926477 13:69147494-69147516 GGTTACTAAATGAGATAAAAGGG - Intergenic
1110050752 13:70895463-70895485 GAATATTAAAGGAGGAAAAAAGG + Intergenic
1110069766 13:71159560-71159582 GACAAATAAATGGAAAAAAAAGG + Intergenic
1110095856 13:71519509-71519531 GTTTTATAAATGGGAAAAATGGG - Intronic
1110315517 13:74101790-74101812 CATCAGTAAATGGGGAAAAAGGG + Intronic
1110530920 13:76596596-76596618 CATGATTTAATGGGAAAATATGG + Intergenic
1110583773 13:77163343-77163365 CAATATTAAGTGGGAGAAAAGGG + Intronic
1111166883 13:84470361-84470383 AAATAATAAATGGAAAAAAAAGG - Intergenic
1111327068 13:86712693-86712715 TATTATTAAATATAAAAAAAAGG - Intergenic
1111802836 13:93000583-93000605 TATTAGGAAATGGAAAAAAAGGG + Intergenic
1112416652 13:99208593-99208615 AAGTCTTAACTGGGAAAAAAAGG - Intronic
1113069777 13:106409327-106409349 GATTCTTAAAAGTGAACAAAAGG + Intergenic
1113322992 13:109255018-109255040 GATTATTAAAATGGAGAGAATGG + Intergenic
1113478347 13:110601645-110601667 GTTTCTTAAATGGTAAGAAATGG + Intergenic
1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG + Intergenic
1113692877 13:112324127-112324149 CTTTATTAAATGGGAAAACATGG + Intergenic
1114259881 14:21028888-21028910 CATTATTAGATGGGAAAAGGAGG + Intronic
1114283497 14:21217503-21217525 GGTAATTAAGGGGGAAAAAATGG + Intronic
1114542893 14:23475917-23475939 GAATATAAAAAGGGAAAAAAGGG - Intronic
1114744337 14:25131664-25131686 AAATATAAAATAGGAAAAAAAGG - Intergenic
1115415750 14:33131599-33131621 GATTATTAGATGACAAAAAAGGG - Intronic
1115662434 14:35510589-35510611 GATAATTAAAAAGGAAAAAGTGG - Intergenic
1116869231 14:50055836-50055858 GCTCATTTAATGGGAAATAAAGG + Intergenic
1118121496 14:62849268-62849290 AATTTTTAAATGAGCAAAAAAGG + Intronic
1118372719 14:65151480-65151502 GATTATTTATTGGAAAATAAAGG - Intergenic
1118414515 14:65520228-65520250 CATAATTAAATGGCAAAGAACGG + Intronic
1118670580 14:68121880-68121902 GATAGTTAAATGGAAAAAAATGG + Intronic
1118715923 14:68560073-68560095 GATTATTAGTTGGGAAAATGGGG - Intronic
1118986259 14:70757787-70757809 AATAATTCGATGGGAAAAAATGG + Intronic
1119124314 14:72111486-72111508 GAATCTTAAATGGGAAGACAAGG + Intronic
1119168809 14:72516934-72516956 GAATCCTAAATGGCAAAAAATGG + Intronic
1119794572 14:77384411-77384433 GATTAAAAAATGGGAGAAAGGGG - Intronic
1120299409 14:82687276-82687298 GATGATTAAAGGGGGAAAATTGG + Intergenic
1120497062 14:85250783-85250805 GATTAATTAATAGAAAAAAATGG + Intergenic
1120686363 14:87542583-87542605 GATTAATGAATGGGACAAACAGG + Intergenic
1121997887 14:98618387-98618409 AAATATTAAATAGGACAAAAAGG + Intergenic
1123678617 15:22739235-22739257 TATTATTAAATGAGAAAAAAAGG - Intergenic
1123826038 15:24083066-24083088 GAGTATTATATGGGAAACAGCGG - Intergenic
1124330821 15:28813516-28813538 TATTATTAAATGAGAAAAAAAGG - Intergenic
1124809901 15:32925525-32925547 AATTACAAAAGGGGAAAAAATGG + Intronic
1124832701 15:33164441-33164463 GGTTATTAAAGGGAAAAAAAGGG + Intronic
1124893611 15:33756089-33756111 GATTGTTAAAGTAGAAAAAAGGG + Intronic
1124998850 15:34751119-34751141 GATAATTCAAAGGGAACAAAGGG + Exonic
1125104059 15:35950040-35950062 GGTTATCAGCTGGGAAAAAAAGG + Intergenic
1125230931 15:37453968-37453990 AATTATTAAATACAAAAAAATGG - Intergenic
1125253544 15:37734675-37734697 CATTATTTAATAGGAAAAACAGG + Intergenic
1125299595 15:38240595-38240617 AGTTATTAAATGAGCAAAAATGG + Intergenic
1125707970 15:41758010-41758032 AAGAATTAAAAGGGAAAAAAAGG - Intronic
1126040050 15:44581591-44581613 GATTATTAAAAAAAAAAAAAAGG + Intronic
1126564549 15:50081353-50081375 AAATAGTAAATGGGCAAAAAAGG + Intronic
1126602196 15:50440198-50440220 GATTTTCAGATGGGAAACAATGG + Intronic
1127827900 15:62721722-62721744 GTTTATTAAATTGGAAAAAATGG + Intronic
1128439144 15:67687673-67687695 GTCCATTAAATGGGAAAAGATGG + Intronic
1129150099 15:73683328-73683350 GAAGATTAAATGAGATAAAATGG + Intergenic
1131361557 15:91796050-91796072 GATTAATAAACTGGAAAAACAGG + Intergenic
1131594017 15:93778592-93778614 TATTGTTAAATGGAAAAACAAGG - Intergenic
1131624730 15:94105493-94105515 GAATATTCCATGGGAAACAAAGG - Intergenic
1131714094 15:95089827-95089849 GAATATTAAATGAGATAATATGG - Intergenic
1132477894 16:151437-151459 AATTTTTAAATGGGCAAAACAGG + Intergenic
1134033445 16:11011102-11011124 GCTTATTAGTTGGGAAGAAAAGG - Intronic
1134159744 16:11877848-11877870 GATTTTGAAAAGGTAAAAAAAGG - Intronic
1134484520 16:14646849-14646871 GATTCTAAGATGGGAAAATAAGG - Intronic
1134836190 16:17363244-17363266 AATTATTCAGTGGGAAAAGAGGG + Intronic
1135837292 16:25837987-25838009 GGTTATTCACTGGGAAAACATGG - Intronic
1135946209 16:26867197-26867219 GATCCATAAAGGGGAAAAAATGG - Intergenic
1136679964 16:31954391-31954413 GAGTATTAAATAAGTAAAAATGG + Intergenic
1136733560 16:32441809-32441831 CATAATTAAAAGGGAAAAAATGG - Intergenic
1136780310 16:32895935-32895957 GAGTATTAAATAAGTAAAAATGG + Intergenic
1136890098 16:33963709-33963731 GAGTATTAAATAAGTAAAAATGG - Intergenic
1136949542 16:34699336-34699358 CATTATCAAATGGAATAAAATGG - Intergenic
1137091608 16:36198687-36198709 CATCATAAAATGGGAAAGAATGG - Intergenic
1137094366 16:36234872-36234894 AATAATTGAATGGGATAAAATGG - Intergenic
1137095304 16:36247386-36247408 GATCATTAAATGGAATCAAATGG - Intergenic
1137258036 16:46793909-46793931 TATCATTAATGGGGAAAAAACGG + Intergenic
1137914083 16:52409775-52409797 GACAATTAAATGGAGAAAAAAGG - Intergenic
1138051266 16:53781155-53781177 GATTACTCAATTGGAAAAATAGG - Intronic
1138235489 16:55378780-55378802 GTTTTTTAAATGGGCCAAAATGG + Intergenic
1138484070 16:57324687-57324709 GACTACTTAAGGGGAAAAAAGGG + Intergenic
1138926459 16:61597541-61597563 CATTAGTAAGTGGGAATAAATGG - Intergenic
1139008326 16:62601139-62601161 GATTATTACATGTGAAAGGAAGG - Intergenic
1139015101 16:62680074-62680096 GAAAATTAAGTGAGAAAAAAAGG - Intergenic
1139015938 16:62688704-62688726 GATTTTTAAAGGAAAAAAAAAGG - Intergenic
1139180427 16:64741471-64741493 GAGAATGCAATGGGAAAAAAAGG - Intergenic
1139410664 16:66757085-66757107 GTTTATCAAGGGGGAAAAAATGG + Intronic
1139553415 16:67689804-67689826 TATTATTTAATGGGAATAATGGG - Intronic
1140455588 16:75103683-75103705 GTTTTTAAAAGGGGAAAAAACGG + Intronic
1140841734 16:78845934-78845956 AATTATTTTATGGGAAAAACTGG - Intronic
1141265441 16:82492753-82492775 TTTTTTTAAATGGGAAAAAGAGG + Intergenic
1141547227 16:84778325-84778347 GTATATTAAATGAGAAAACAAGG - Intronic
1142301401 16:89260553-89260575 CCTTATTAAAAGGAAAAAAAGGG + Intergenic
1203019523 16_KI270728v1_random:387793-387815 CATAATTAAAAGGGAAAAAATGG + Intergenic
1203037858 16_KI270728v1_random:660951-660973 CATAATTAAAAGGGAAAAAATGG + Intergenic
1203082934 16_KI270728v1_random:1159905-1159927 GAGTATTAAATAAGTAAAAATGG + Intergenic
1142897854 17:2993732-2993754 GACTTTAAAATGTGAAAAAACGG + Intronic
1142908373 17:3064407-3064429 GTTTTTTAAATGTGAAAAATGGG + Intergenic
1142926193 17:3239855-3239877 GTTTTTTAAATGTGAAAAATGGG - Intergenic
1142956729 17:3527871-3527893 AGTTATAACATGGGAAAAAATGG - Intronic
1143281248 17:5756115-5756137 AATAAATAAATAGGAAAAAAAGG - Intergenic
1143578723 17:7811066-7811088 GAATGCAAAATGGGAAAAAATGG - Intronic
1143974993 17:10823088-10823110 CATTCTTAAATGGGAGCAAATGG - Exonic
1143980213 17:10862670-10862692 GATTATTAATGAGGAAAAAGAGG + Intergenic
1144276142 17:13670069-13670091 GAATATTAAGAGAGAAAAAAAGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1147003354 17:37381490-37381512 TATTATTAAATGGAAAAGCAAGG - Intronic
1148725262 17:49784757-49784779 GAGTATTACATGGGAAAATAGGG - Intronic
1148979562 17:51560649-51560671 GCTTATTAAATGGGACAGAAAGG - Intergenic
1149258690 17:54855974-54855996 TATTATTAAAAAGGAAAAAGTGG + Intergenic
1149383886 17:56122939-56122961 GCTTATTAAATGGAAAAGGAGGG + Intronic
1149763565 17:59255040-59255062 GTACATTAAAGGGGAAAAAAAGG - Intronic
1149784117 17:59421206-59421228 GATTATTAGATGACAAATAATGG - Intergenic
1149814471 17:59709532-59709554 AATTATTAAATATGAAAATATGG + Intronic
1149863254 17:60136040-60136062 AATTAATGAATGGGACAAAATGG + Intergenic
1150763264 17:67981327-67981349 GATCATAAAATGGGAAAATATGG - Intronic
1150771545 17:68045980-68046002 TATTTTTAAAAGGGAAAAAAAGG - Intronic
1150869096 17:68884979-68885001 GATTAATATATGGGAAGGAAGGG - Intronic
1151050091 17:70968167-70968189 TTCTATTAAATGGGAAAAAATGG + Intergenic
1151070303 17:71202522-71202544 GATTAGGGAATGGGAACAAATGG + Intergenic
1151411394 17:73932577-73932599 TATTATTAAAAAGGATAAAACGG + Intergenic
1153015537 18:579728-579750 GTTTTTTAAATGGTATAAAAAGG + Intergenic
1153042280 18:824606-824628 ATTTATTAAATAGGAAATAATGG - Intergenic
1153115758 18:1653462-1653484 AATTGGTAAGTGGGAAAAAAAGG - Intergenic
1153372121 18:4331091-4331113 GAATATTACTGGGGAAAAAAGGG - Intronic
1153506596 18:5805951-5805973 AATTATTAAAAGAGAAATAAAGG - Intergenic
1153660606 18:7322344-7322366 GATTTTTATATGGGAAAGAAGGG + Intergenic
1153780984 18:8495000-8495022 GGTTATTTATTGTGAAAAAATGG + Intergenic
1153844196 18:9033612-9033634 CATTCTTAAAGGGGAGAAAAAGG - Intergenic
1153936969 18:9936092-9936114 CATTACTAAATAAGAAAAAAAGG - Exonic
1155040396 18:22060536-22060558 GATTAGGAAATGGAAAAAAGAGG + Intergenic
1155303158 18:24451886-24451908 GATGAATAGAGGGGAAAAAATGG - Exonic
1155600112 18:27535781-27535803 TCTTATTTAATGGGGAAAAAGGG + Intergenic
1155777228 18:29779962-29779984 CATTAATAAATGAGAAGAAAGGG + Intergenic
1155975068 18:32119835-32119857 GATTATCAAACAGGAAAAAAAGG - Intronic
1156152484 18:34258971-34258993 GATTAGTAATTGGGTCAAAATGG + Intergenic
1156207713 18:34904547-34904569 GATTTTTAAATAGAAAAAAAAGG + Intergenic
1156697824 18:39788847-39788869 CATTATGAAATAAGAAAAAAAGG + Intergenic
1156731889 18:40204410-40204432 GATTATGAAATTTGAAACAACGG + Intergenic
1157144159 18:45144186-45144208 GAGTAGTCTATGGGAAAAAAGGG + Intergenic
1158163874 18:54517373-54517395 AATTATTAAGTAGGAAAAAGAGG - Intergenic
1158778543 18:60617080-60617102 GAACATTAAATGGGTAGAAAAGG - Intergenic
1159095982 18:63902377-63902399 TATTATTAAAAGGTAAAATATGG - Intronic
1159756037 18:72367304-72367326 AGTGATTAAATAGGAAAAAAGGG + Intergenic
1159872633 18:73775763-73775785 TTTTATTCATTGGGAAAAAAAGG + Intergenic
1159932474 18:74327920-74327942 AAATATTAAATGGCAAAATATGG - Intronic
1160062201 18:75541921-75541943 AATTAATAAAAGGAAAAAAATGG + Intergenic
1162593490 19:11608815-11608837 GATTAGAAAATGGGCAAAATTGG - Intronic
1162679049 19:12324845-12324867 GATAAATAAAAGTGAAAAAATGG + Intronic
1162696368 19:12479484-12479506 GATTATTAAGTAGTAAAATATGG - Intronic
1163174612 19:15555712-15555734 GAGGATTAAATGGGAATATATGG - Intergenic
1166192224 19:41182659-41182681 GATTTTTAAAGGTAAAAAAAGGG + Intergenic
1167024187 19:46902861-46902883 GATTCTTCACTGGGCAAAAAGGG + Intergenic
1167816808 19:51889935-51889957 GATTGTTAACTGGATAAAAAAGG + Exonic
1168418612 19:56185779-56185801 ACTAATTAAAAGGGAAAAAATGG - Intergenic
1168551034 19:57294556-57294578 GATTTTAAAATGGGTAAATAAGG - Intergenic
1168646956 19:58065626-58065648 GGTCCTTAAATGGGGAAAAAAGG - Intronic
1168668606 19:58224006-58224028 GAATATTAAAGGGTAAAACATGG - Intergenic
925432146 2:3803905-3803927 CATAATTAAAGGGGAAAACACGG - Intronic
925662686 2:6219699-6219721 CATCTGTAAATGGGAAAAAATGG - Intergenic
925808925 2:7679282-7679304 AATTATGATATGGGAAAAACAGG + Intergenic
926335704 2:11861057-11861079 AATAAATAAATGGGAAATAAAGG + Intergenic
926981355 2:18573927-18573949 AATTGTTTAATGGGAGAAAAAGG + Intronic
926993797 2:18711476-18711498 CATTATTAACTGAGAAAATATGG + Intergenic
927659059 2:24976682-24976704 CATTAATAAATGGAAAAAATTGG - Intergenic
927953267 2:27188899-27188921 GACAATTGAATGGGGAAAAATGG + Intergenic
928745970 2:34415812-34415834 ACTTTTTGAATGGGAAAAAAAGG + Intergenic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
929325580 2:40606871-40606893 AATTTGTAAATGAGAAAAAATGG - Intronic
929621359 2:43358124-43358146 GATTCATACATGGGATAAAATGG - Intronic
929657047 2:43744290-43744312 GCTGAATAAATGGAAAAAAATGG - Intronic
929691915 2:44082060-44082082 GTTTATTGAAGGGGAAAAATTGG - Intergenic
930440644 2:51400829-51400851 GATTAATAAAATGCAAAAAAAGG - Intergenic
930502523 2:52239760-52239782 AATTCTTAAATGGGAAAACTAGG - Intergenic
930535496 2:52641046-52641068 AGTTATTTAATGGGAAAAATAGG - Intergenic
930695277 2:54405422-54405444 GATTATTTTAAGGGCAAAAAAGG + Intergenic
931326320 2:61228655-61228677 CATTTTTACATGGGAACAAAAGG - Exonic
931404806 2:61965665-61965687 GGTTACTAAATGTGCAAAAATGG + Intronic
931692477 2:64846895-64846917 GATTTTAAAATGTGAAAAAAGGG - Intergenic
933151893 2:78925151-78925173 GATTATAAAATGAGATAAACAGG + Intergenic
933205406 2:79501817-79501839 GAGCATTAATTGGGAAAGAATGG + Intronic
933448618 2:82416048-82416070 GATTATTGAATAGAAAAATAAGG - Intergenic
933502852 2:83138579-83138601 GAAAATTACAGGGGAAAAAAAGG + Intergenic
934312159 2:91877459-91877481 CATAATTAAAAGGGAAAAAACGG + Intergenic
934876825 2:97929351-97929373 GCTGAATAAATGGGAGAAAAGGG + Intronic
935038450 2:99402206-99402228 TTTTATCAAATGGGAAAAAATGG - Intronic
935501971 2:103852428-103852450 GATTATTTAATGAAAAAAATTGG + Intergenic
936672968 2:114680942-114680964 GAATCTTAAATGAGAAAACATGG - Intronic
936745111 2:115566405-115566427 AATGAATAAATGGGAAAGAATGG - Intronic
937522614 2:122730874-122730896 GCTTATAAAATGGGAGAAATAGG + Intergenic
937720845 2:125093986-125094008 GGATATTAAATAGGACAAAAAGG - Intergenic
937727826 2:125187837-125187859 GGTTTTTAAAAGGGGAAAAAAGG + Intergenic
937727827 2:125187838-125187860 GTTTTTAAAAGGGGAAAAAAGGG + Intergenic
937779180 2:125818051-125818073 GAGTTTAAAATGGAAAAAAATGG - Intergenic
937922671 2:127142820-127142842 GATTTGTAAATGTGAAAAATTGG - Intergenic
938027610 2:127964018-127964040 CATTTTAAAATGGGTAAAAAGGG - Intronic
938038502 2:128056121-128056143 GATTTACAAATGGGAGAAAAAGG + Intergenic
938404532 2:131023125-131023147 AATTATTAAATAGGCAAAAGAGG + Intronic
938709206 2:133960940-133960962 CATCATTAAATGGGACAGAATGG + Intergenic
938837403 2:135120162-135120184 ACATATTAAATGTGAAAAAAAGG - Intronic
938950212 2:136248366-136248388 GAATATTACAGGGGATAAAACGG - Intergenic
939015104 2:136893454-136893476 TATTATTAACTGGGAAATACAGG + Intronic
939111261 2:138010399-138010421 GTTTAATAAATAGGAATAAAAGG + Intronic
939146002 2:138415440-138415462 CATTTTTAAATGGGCAAAGATGG + Intergenic
939291165 2:140196735-140196757 TATTATTAACTGAGGAAAAATGG + Intergenic
939296941 2:140278727-140278749 CATTTTTAGAGGGGAAAAAATGG - Intronic
939387698 2:141522023-141522045 GACTATTAAGTAGGAAAACAGGG + Intronic
939463458 2:142527392-142527414 GATTATTGAATTTAAAAAAATGG - Intergenic
939597450 2:144144013-144144035 GCTTCTTAATGGGGAAAAAATGG - Intronic
939984847 2:148819743-148819765 CATTATTAACTGAGGAAAAATGG - Intergenic
940255948 2:151729408-151729430 GTTTTTTGAATAGGAAAAAAAGG + Intronic
940513816 2:154653698-154653720 GATTACTAAATTGCCAAAAATGG + Intergenic
940712740 2:157182037-157182059 GAAAAGTAAATGGGATAAAATGG - Intergenic
940955988 2:159727834-159727856 GATTATTAAATACGTATAAACGG - Intronic
941486976 2:166094192-166094214 AAATATTAAATGAGAAAACAAGG + Intronic
941520947 2:166542007-166542029 GAAACTTCAATGGGAAAAAAAGG + Intergenic
941531900 2:166680626-166680648 TTTTATTAAAATGGAAAAAATGG + Intergenic
941713354 2:168738352-168738374 GATTATTAAATGATAAATAATGG + Intronic
943019499 2:182555533-182555555 TATTCTTAAATGTGAAGAAAGGG - Intergenic
943510448 2:188819723-188819745 GATTTTTAAAGGCAAAAAAAGGG + Intergenic
943560942 2:189460846-189460868 TATTTTTAAATGAGAAATAATGG + Intronic
943802050 2:192072776-192072798 CATTTTTAAATGGGAGAGAAGGG + Intronic
943928021 2:193812662-193812684 GTGTATTAAATGGGCAGAAAGGG + Intergenic
944048944 2:195444704-195444726 TATTATTGAAAGGGAGAAAATGG - Intergenic
944072221 2:195684630-195684652 GATTATAGAATGGGAAAAAAAGG - Intronic
944959199 2:204851159-204851181 GGTTAATAAATGGGAAATAATGG - Intronic
945129427 2:206553075-206553097 GATGTTTAAAAAGGAAAAAAAGG + Intronic
945280529 2:208031248-208031270 AACTATAAAATGGGAAGAAAGGG - Intergenic
945515115 2:210753899-210753921 GATTTTTATAGGGAAAAAAAAGG - Intergenic
945706434 2:213239457-213239479 TATTATGAAATGAGACAAAATGG + Intergenic
945765177 2:213967659-213967681 GATTATTAAATAGCAAAGTAAGG + Intronic
946610849 2:221455943-221455965 AATTATTAAATAAGAATAAAAGG - Intronic
946919962 2:224568709-224568731 AAATATTAACTGGGAAAAAAAGG + Intronic
947256819 2:228175731-228175753 GATTTTTAGATGAGATAAAAAGG + Intronic
947308198 2:228770965-228770987 TCTTCTTAAATGGAAAAAAATGG + Intergenic
947356988 2:229307015-229307037 CATTATAAAATGGGAAAATGTGG - Intergenic
947824618 2:233096738-233096760 TATTTTTAAAAAGGAAAAAATGG - Intronic
948012441 2:234660402-234660424 GTTAATTAAATGGCAAAAACTGG + Intergenic
948501909 2:238401404-238401426 GATTATTAAAAAGAAAAATAAGG - Intergenic
1169302650 20:4457666-4457688 GATTAGGGAATGGGAACAAAAGG - Intergenic
1169326689 20:4682422-4682444 TTTTCTTAAATGGAAAAAAATGG - Intergenic
1169799447 20:9499961-9499983 CATTAGTAAAAGGGAAAATAGGG - Intergenic
1169874136 20:10278349-10278371 TATTTTTAAATGGGTAAAATGGG + Intronic
1169879538 20:10331478-10331500 CAATATTAAAAGGGAAAGAATGG + Intergenic
1170323705 20:15131463-15131485 GATTATTTAATGATAAAACAGGG + Intronic
1171519985 20:25768336-25768358 GATGATTAAATGAGAGCAAAAGG - Intronic
1171556934 20:26088157-26088179 GATGATTAAATGAGAGCAAAAGG + Intergenic
1172298903 20:33834063-33834085 GAATATTAAAAGGATAAAAAGGG - Intronic
1172732587 20:37100388-37100410 AATTATGAAAATGGAAAAAAGGG + Intergenic
1173033461 20:39384246-39384268 CATTACTAATTAGGAAAAAAAGG - Intergenic
1173168447 20:40702816-40702838 CATTTTTAAATGTGAGAAAAAGG + Intergenic
1173168958 20:40707031-40707053 GAATCATAAATGGGAATAAATGG + Intergenic
1173264178 20:41463198-41463220 AATAAATAAATGGGAGAAAAAGG + Intronic
1173445993 20:43118736-43118758 GTTTATAAAATGGGAATATATGG - Intronic
1174063669 20:47849591-47849613 GATTACTAAAGGGGAAAAGAAGG - Intergenic
1175017726 20:55809926-55809948 GATTAATAACTGGTATAAAAGGG - Intergenic
1175265144 20:57698310-57698332 GTTTATGATATGGGAAAAAGAGG - Intronic
1175767917 20:61603816-61603838 GAGTACTAAATGAGAAAATAGGG + Intronic
1176928221 21:14776048-14776070 AATTATTATTTGGGAAAAGAGGG + Intergenic
1177096063 21:16834744-16834766 ACATATTGAATGGGAAAAAATGG + Intergenic
1177304481 21:19295439-19295461 GATTAATAAAGAAGAAAAAAGGG + Intergenic
1177469493 21:21539499-21539521 GATTATTAAATGTAAAATTAAGG + Exonic
1177594884 21:23225740-23225762 AAATTTAAAATGGGAAAAAAAGG + Intergenic
1177623071 21:23621928-23621950 GTTTATTAAATGTGAATAGATGG + Intergenic
1178252949 21:31021895-31021917 GAATAATAAATAGGAAAAACAGG + Intergenic
1178705497 21:34869485-34869507 GAATATTAAATAGGACACAATGG + Intronic
1179120156 21:38537036-38537058 GATCATTTAATGAGAAAAAAAGG + Intronic
1180529963 22:16341868-16341890 GATTATCAAATGGTATCAAATGG - Intergenic
1180538919 22:16423274-16423296 CATAATTAAAAGGGAAAAAACGG + Intergenic
1180701989 22:17786093-17786115 GCTTATAAAATGGAATAAAATGG + Intergenic
1181739566 22:24909998-24910020 GAATATTATTTGGCAAAAAAAGG + Intronic
1181906885 22:26205049-26205071 GAATAATGAATGGGAAAACAAGG - Intronic
1181908265 22:26217004-26217026 GAGGATTAAATGGGAATAACTGG + Intronic
1182131083 22:27851383-27851405 TATTTTTAAAGGGGAAAACAGGG - Intergenic
1182132071 22:27861742-27861764 GATGATTAAAAGAAAAAAAAGGG + Intronic
1183735243 22:39641390-39641412 GACTATTAAATGGCAAAAATAGG + Intronic
1184508952 22:44920933-44920955 GTTTATTAACTGGAAAAAGATGG - Intronic
1203319685 22_KI270737v1_random:43943-43965 GATTATCAAATGGTATCAAATGG + Intergenic
1203329332 22_KI270738v1_random:64294-64316 AATTATTGAATGGGAATGAATGG + Intergenic
949395235 3:3607671-3607693 AATTATTTAATGGGAAATGAGGG + Intergenic
950072390 3:10163229-10163251 GATTATTAAATAGGGTATAAGGG - Intergenic
950636539 3:14319432-14319454 GATTTTTAACTGGGAAAAACTGG + Intergenic
950956427 3:17058243-17058265 GAATATCACATGGGAAAAACAGG + Intronic
951159546 3:19400644-19400666 GAATCTAGAATGGGAAAAAAGGG + Intronic
951410784 3:22363348-22363370 CATCATTAAAAGGGGAAAAATGG + Intronic
951495728 3:23323711-23323733 GTTTGCTAAAAGGGAAAAAAAGG - Intronic
951567643 3:24027284-24027306 GGTTATTAAAAGGAAGAAAAAGG - Intergenic
951989907 3:28664901-28664923 GAGTATTAAGTAAGAAAAAATGG - Intergenic
951997259 3:28744849-28744871 GAGGAGTAAATGGAAAAAAATGG + Intergenic
952090458 3:29878651-29878673 AATTTTTAAGAGGGAAAAAAGGG - Intronic
952489238 3:33850650-33850672 TATTATTAAATGAGAAAAAAAGG - Intronic
952579319 3:34812647-34812669 ACTTATTAAATGAGAAAGAATGG + Intergenic
952653999 3:35761668-35761690 GATTATTCAATGGTGAAAAGTGG + Intronic
952939192 3:38428568-38428590 GAATATTAACAGGGAAAAAGAGG - Intergenic
953301629 3:41782839-41782861 AATTATTAAATGTGCAAAAGAGG + Intronic
953559661 3:43976988-43977010 GATTATTACAGGAGAAAAGATGG - Intergenic
955273059 3:57520734-57520756 GATTAGAAAATGGGTAAAAACGG - Intronic
955563073 3:60213940-60213962 GATTTTTATATGTGAAAAATGGG + Intronic
955668199 3:61372549-61372571 GGTTTTTAAAATGGAAAAAAAGG - Intergenic
955809596 3:62772995-62773017 AATCATTATCTGGGAAAAAAGGG + Intronic
955853155 3:63242810-63242832 GATGTTTAAATAGGTAAAAAAGG + Intronic
956275739 3:67499316-67499338 GGTTTTTTAATTGGAAAAAATGG + Intronic
956368803 3:68535814-68535836 GGTTTTTAAAGGGGGAAAAATGG + Intronic
956416271 3:69033342-69033364 CATTGTGTAATGGGAAAAAATGG + Intronic
956507264 3:69955511-69955533 CATTTTTAAATGGTTAAAAAAGG + Intronic
956535924 3:70276608-70276630 GATTATTAGAAGGTAAACAAAGG - Intergenic
957187689 3:76964193-76964215 GATTATTAAAGGGAAAAATGTGG + Intronic
957228393 3:77478297-77478319 TATTATTCAATTGGAAAAACTGG - Intronic
957648732 3:82970881-82970903 GATTATTGACTGGGAAGACAAGG - Intergenic
957705799 3:83781375-83781397 CCTAAATAAATGGGAAAAAAAGG - Intergenic
958510699 3:95044078-95044100 GATTTATAAAATGGAAAAAATGG - Intergenic
958539061 3:95446614-95446636 CATTATTAAATTGTAAACAAGGG - Intergenic
958590052 3:96145312-96145334 GATCATCTAATGGGAAAGAAGGG - Intergenic
958606044 3:96359971-96359993 GAATAGTAAGTGGGAAAAACAGG - Intergenic
958933549 3:100233227-100233249 TATTACTGAATTGGAAAAAATGG - Intergenic
959073607 3:101726691-101726713 GATTATTAAATTGGAAAATCTGG + Exonic
959646223 3:108705237-108705259 GATTAGTGAATGGGAAGATATGG + Intergenic
960132780 3:114075226-114075248 TGTTATTATATGGGCAAAAATGG + Intronic
960215083 3:115024172-115024194 GATTATTACAAGGAAGAAAAAGG - Intronic
960274942 3:115718076-115718098 GATTAGGAAATGAGAGAAAAAGG - Intronic
960295240 3:115934985-115935007 AATTATTTATTGGGAAATAAAGG + Intronic
960980077 3:123215716-123215738 CATTATTATCTGGTAAAAAATGG + Intronic
961119460 3:124361434-124361456 TATCATTAAATGAGAAAAACTGG - Intronic
962579809 3:136788151-136788173 GACTATTAGATGGCAAAAAAAGG + Intergenic
962855728 3:139343214-139343236 GATTATAAAATGGGCTATAAAGG + Intronic
963563483 3:146897783-146897805 AAGCATTAAATAGGAAAAAATGG + Intergenic
963610916 3:147467156-147467178 AATTTTTAAATTGTAAAAAAAGG + Intronic
963714951 3:148792525-148792547 GATTTTTAAAAGGGATTAAAAGG - Intronic
965053621 3:163685188-163685210 AATTGTTAACTGAGAAAAAATGG - Intergenic
965137942 3:164798428-164798450 GATTCTATAATGGGAAAGAAAGG - Intergenic
965327755 3:167328857-167328879 AATTATTAAATGGGGGAAAGGGG - Intronic
965853384 3:173058601-173058623 GATAATTAGATGGACAAAAATGG + Intronic
966574575 3:181485405-181485427 AACTATCAAATAGGAAAAAAAGG - Intergenic
966658341 3:182385197-182385219 GATTGTTGAGGGGGAAAAAAAGG - Intergenic
967071216 3:185963841-185963863 GACTTTGAAATGGGAAAAAAAGG + Intergenic
967538524 3:190636461-190636483 GAGTATTAACAGAGAAAAAACGG - Intronic
967613618 3:191538194-191538216 GCATATCAAATGGGGAAAAATGG + Intergenic
968681262 4:1921816-1921838 GTTTATTAAATGGTGAAAAATGG - Intronic
969938770 4:10709524-10709546 GATAAATTAATGGCAAAAAATGG + Intergenic
970043467 4:11822896-11822918 TAAAATTAAATGAGAAAAAAAGG + Intergenic
971249392 4:24960642-24960664 GAATATTAACAGGGATAAAATGG + Intronic
971655295 4:29336351-29336373 GTTTTTAAAATGGGAAATAAAGG - Intergenic
971691251 4:29839681-29839703 GATTATTACATGTGAGAAAGAGG + Intergenic
971691267 4:29839832-29839854 GATTATTACATGTGAGAAAGAGG + Intergenic
971864046 4:32145682-32145704 GATTATAGAATGGGAAAAAAAGG + Intergenic
971964989 4:33542264-33542286 AATTATTACATGGGGAGAAAAGG + Intergenic
972114989 4:35620275-35620297 GATTATACAATTGAAAAAAATGG + Intergenic
972141137 4:35960793-35960815 CATTATTAACTGGAAATAAAAGG - Intronic
972237678 4:37152846-37152868 AATTATTAAATAGAAAAATAAGG + Intergenic
972968805 4:44547089-44547111 GAGTATCAAATGGCAAATAAAGG - Intergenic
973076504 4:45934327-45934349 CATTATTAAATATCAAAAAATGG + Intergenic
973120642 4:46517404-46517426 TATTAATGAAGGGGAAAAAAAGG + Intergenic
974091074 4:57312027-57312049 GATAATTAAATGGTAATAGAAGG + Intergenic
974268776 4:59622466-59622488 AAGTCATAAATGGGAAAAAATGG + Intergenic
974289945 4:59916344-59916366 GATTTTTAAATAGAAAAAAAAGG - Intergenic
974390778 4:61264530-61264552 GATTTTTAAAAAGGAAGAAAGGG - Intronic
974557444 4:63469518-63469540 ATGTAATAAATGGGAAAAAATGG - Intergenic
974572618 4:63673541-63673563 GATAATTCAATGGGAAAAGCAGG + Intergenic
975045654 4:69800272-69800294 GAATATTAAATGAGAATTAAAGG + Intergenic
975258374 4:72267204-72267226 GAATATTGAAATGGAAAAAAGGG + Intergenic
975436109 4:74353786-74353808 GATATTTAAAGGGGAAAAAGTGG + Intergenic
975654546 4:76628776-76628798 GATTAGTGCATGGGAAAAAATGG + Intronic
976120611 4:81776814-81776836 GATTTTTAATTGGAAAGAAAAGG + Intronic
976179330 4:82384237-82384259 GATTATATAATGGAAATAAAGGG + Intergenic
976417640 4:84797216-84797238 AATTAATAATGGGGAAAAAATGG - Intronic
976528555 4:86122066-86122088 CATTATTAACTGAGAAAAATGGG + Intronic
976568286 4:86577788-86577810 GATCATTGAATTGGAAAAACAGG + Intronic
976691748 4:87875745-87875767 GATGATTAAATGGAAATTAAAGG - Intergenic
976737194 4:88322435-88322457 GATTTTTTAAAGGCAAAAAAAGG + Intergenic
976769083 4:88632011-88632033 GATGATAAGAGGGGAAAAAATGG - Intronic
976780562 4:88754004-88754026 AATTATTTAAAGGGAAAAACAGG + Intronic
976953107 4:90858190-90858212 CATCCTGAAATGGGAAAAAATGG + Intronic
977319464 4:95493932-95493954 AATTTTTAAAAGCGAAAAAATGG - Intronic
977350197 4:95874758-95874780 GATGGTTGTATGGGAAAAAAAGG + Intergenic
977389880 4:96393955-96393977 ACTTATTAAATGTGAACAAATGG + Intergenic
977605104 4:98976602-98976624 TATTTTTAAATTTGAAAAAATGG - Intergenic
977936050 4:102805845-102805867 TATTAATAAACAGGAAAAAAGGG - Intronic
978270212 4:106879736-106879758 AATTGTTAAATGGTCAAAAATGG + Intergenic
978351834 4:107827390-107827412 GATTATCAAGAGGGGAAAAAAGG + Intronic
978610143 4:110528923-110528945 GAGTATAAAATGTGAAGAAATGG - Intronic
978943218 4:114462352-114462374 GGGTTTTAAATGGAAAAAAAAGG - Intergenic
978977050 4:114890474-114890496 GATAATGACATGAGAAAAAAAGG - Intronic
979210957 4:118102076-118102098 GTTTATTTATTGAGAAAAAATGG + Intronic
979216800 4:118174949-118174971 GATTATAAAATGTGAAAGGAAGG - Intronic
979461945 4:120993928-120993950 GAGTATTAATTGGGAAAGAGAGG + Intergenic
979724493 4:123943633-123943655 CATGATTAAATGAGAAAGAATGG - Intergenic
979759934 4:124390010-124390032 GATTTTTAGATGTTAAAAAAGGG + Intergenic
979781574 4:124657907-124657929 AATTATAAAATGGTAATAAAAGG + Intergenic
979908015 4:126321908-126321930 AATTATGAAAAAGGAAAAAATGG - Intergenic
980304495 4:131040310-131040332 AACTAATAAATGGGAAAAATAGG + Intergenic
980491955 4:133540010-133540032 AAATATTAAATAGGAAAAACAGG - Intergenic
980635857 4:135501829-135501851 TATTTTTAAATGGAAAAAATAGG + Intergenic
980927519 4:139153132-139153154 GATAATAAAATGAGAAGAAAAGG + Intronic
981284468 4:142999668-142999690 AATAAATAAAAGGGAAAAAAAGG - Intergenic
981621612 4:146706449-146706471 CAAGATTAAATGGGAATAAAAGG + Intergenic
981662183 4:147180915-147180937 TATTATTAAATAAGAAAGAATGG + Intergenic
981690538 4:147503973-147503995 AATTATTTAGTGCGAAAAAATGG + Intronic
982197561 4:152932004-152932026 GATCATTAAGAGGGAGAAAAGGG - Intergenic
982215256 4:153077270-153077292 AATAATAAAATGGGACAAAAAGG - Intergenic
982242914 4:153318534-153318556 AATTATTAAAATGCAAAAAAGGG - Intronic
982694868 4:158588334-158588356 CATTGTTAAATGGAAAAAACCGG + Intronic
982746412 4:159107587-159107609 GATTATTAAATAGGAGGAGATGG - Intronic
982757237 4:159235573-159235595 GATTACTTAGTGGAAAAAAATGG - Intronic
983289970 4:165789825-165789847 GGTTATTAAGGGGGACAAAATGG - Intergenic
983399388 4:167244225-167244247 CACTAATAACTGGGAAAAAATGG + Intergenic
983738514 4:171095108-171095130 AATTATTTCATGGGAACAAAAGG + Intergenic
983945009 4:173576121-173576143 GATTATCATAAGGAAAAAAAAGG - Intergenic
984030631 4:174599667-174599689 GATTTATAAATGGGCAAAGAAGG - Intergenic
984058996 4:174967914-174967936 GAGTATTAAATCAGAAGAAAAGG - Intronic
984301557 4:177926090-177926112 TATAATTTAAAGGGAAAAAAAGG + Intronic
984301907 4:177930729-177930751 AACAATTAAATGGCAAAAAAAGG - Intronic
984673805 4:182523801-182523823 TATTTTTAAATAGGAAAATAAGG - Intronic
984809547 4:183782675-183782697 GTCTATTACATGGGAAAAAAAGG - Intergenic
985080600 4:186260574-186260596 TATGTTTAAAAGGGAAAAAATGG + Intergenic
985336535 4:188903117-188903139 AATTTTTAAATGAGAGAAAAAGG - Intergenic
986752272 5:10798599-10798621 GATTCTAAAAAGAGAAAAAAAGG - Intergenic
987013069 5:13787273-13787295 CATTAGTAATAGGGAAAAAAGGG + Intronic
987129448 5:14847273-14847295 GATTACTAAGGGGGAAAAAGGGG + Intronic
987762525 5:22184143-22184165 CTTTATTAAATGGGCAATAATGG + Intronic
987785677 5:22495374-22495396 TATTATTAAAAGTGAGAAAATGG + Intronic
987837689 5:23182420-23182442 AATCATTAAATGTGAAAAACTGG - Intergenic
987857301 5:23437553-23437575 GATTATTAAGTGGGATTAAAGGG + Intergenic
987934100 5:24441646-24441668 TATTATTAGAGGAGAAAAAAAGG + Intergenic
987987431 5:25165539-25165561 TATTATTAAAAAGGAAAAGAAGG + Intergenic
988089841 5:26523980-26524002 GATCATTTAATGTGCAAAAAGGG - Intergenic
988112600 5:26842005-26842027 CATTATTCAATGTGAATAAAAGG - Intergenic
988115053 5:26876360-26876382 CATAAATAAATGTGAAAAAAAGG - Intergenic
988242833 5:28635606-28635628 AATTATTAAATTGGAAAATGTGG - Intergenic
989141977 5:38210531-38210553 GATTACAAAATGGCAAAAAGAGG + Intergenic
989189106 5:38652777-38652799 GATTAAAAAATAAGAAAAAAAGG - Intergenic
989596517 5:43160985-43161007 GATTTTTATGGGGGAAAAAAAGG - Intronic
990014350 5:51040818-51040840 GTTTAGTAATTGGGAAAAATAGG + Intergenic
990043673 5:51401990-51402012 CATTATAGAAGGGGAAAAAAAGG + Intergenic
990525715 5:56624984-56625006 TATTACTAAAGGGGAAAAAAAGG + Intergenic
990633145 5:57692862-57692884 GTTTCTTAAGGGGGAAAAAAGGG + Intergenic
990821363 5:59844397-59844419 AAATATTAAATGGGAAAATCAGG - Intronic
991057029 5:62332670-62332692 GTAGACTAAATGGGAAAAAATGG + Intronic
991677061 5:69098159-69098181 GACTAGTTAATGGGAAATAATGG - Intronic
991897314 5:71417525-71417547 CTTTATTAAATGGGCAACAATGG + Intergenic
992706749 5:79403001-79403023 GAATATTAAATGAGGAAAAACGG - Intronic
992902067 5:81307013-81307035 TTTTATTAAGTAGGAAAAAAAGG + Intronic
993268237 5:85757232-85757254 GAATAATAAATGGCAAGAAAGGG - Intergenic
993431925 5:87842383-87842405 AATTGTAAAATAGGAAAAAATGG + Intergenic
993702022 5:91130133-91130155 AAAAATTAAATAGGAAAAAAGGG + Intronic
993787094 5:92155902-92155924 GATTCTTAGATTGGATAAAAGGG - Intergenic
993813738 5:92514874-92514896 GATTTTTAAAGGCAAAAAAAAGG + Intergenic
994069368 5:95581553-95581575 GAGTATTACATGAGAAAATATGG - Intronic
994319580 5:98377335-98377357 CATTATTTATTGGGAAAAATTGG - Intergenic
994747106 5:103691937-103691959 GATTATGGATGGGGAAAAAAAGG + Intergenic
994800487 5:104367678-104367700 GATTATCTAATGTGCAAAAATGG - Intergenic
994979148 5:106850763-106850785 AATTATTAAATGGGAACTGATGG - Intergenic
995135627 5:108676930-108676952 GTTTGTTAAAAGGGAAGAAATGG - Intergenic
995319054 5:110810909-110810931 GATTACTTAATGAAAAAAAAAGG + Intergenic
995389326 5:111622615-111622637 AATTAATAAAGGGGAAGAAACGG - Intergenic
995399951 5:111729852-111729874 AAATATTAAATTGGAAAACAAGG - Intronic
995778166 5:115747530-115747552 GAAAATTAAATGAGAAGAAAGGG - Intergenic
995807890 5:116074589-116074611 GATTTTTAAATGGACAAAATTGG - Intergenic
995932207 5:117460008-117460030 TATTATTAAATGTAAAATAATGG - Intergenic
996059192 5:119014138-119014160 AATTTTTAAATGAAAAAAAATGG + Intergenic
997650914 5:135519548-135519570 GATTATCACATTGGACAAAAAGG - Intergenic
997698780 5:135881856-135881878 AACTACTAAATGGGAAAAGAGGG - Intronic
998181221 5:139945073-139945095 GATTAAAAAATGGGCAAAAATGG - Intronic
998249380 5:140541148-140541170 AATTATTCAGTGGGACAAAAAGG + Intronic
998355753 5:141534904-141534926 GATTTTTAAATAGGCACAAAAGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
998990868 5:147814778-147814800 TATGATGACATGGGAAAAAATGG + Intergenic
999192721 5:149760504-149760526 GAGAATTAAATGAGAATAAAGGG + Intronic
999801630 5:155043837-155043859 GATTATGAAATGGGGAGAAGAGG - Intergenic
999917817 5:156282778-156282800 TATTATTAAATGGAAAGTAATGG - Intronic
1000138871 5:158381911-158381933 GAGTTTGAAATGGGATAAAAAGG - Intergenic
1000388435 5:160698307-160698329 AAATATTTAAAGGGAAAAAATGG - Intronic
1000551826 5:162675622-162675644 GATTACTAAAAGGTAGAAAAAGG + Intergenic
1000859341 5:166438020-166438042 GAATATTATTTGGCAAAAAAAGG - Intergenic
1001060512 5:168484460-168484482 GATTATTTAATTGGACAAAGAGG + Intergenic
1001202727 5:169733185-169733207 AACTAATAAAGGGGAAAAAAGGG - Intronic
1001337485 5:170811516-170811538 GAAGATTAAATGGTAAAAAATGG - Intronic
1001452397 5:171836697-171836719 GACTCTTTATTGGGAAAAAATGG - Intergenic
1001929955 5:175665761-175665783 GATTATAAAATGGGCAAGAGTGG + Intronic
1002552380 5:180004920-180004942 GAAAAAAAAATGGGAAAAAATGG - Intronic
1002557314 5:180052982-180053004 TATTATTCAGAGGGAAAAAAAGG + Intronic
1003075075 6:2976528-2976550 CCTTATTAAATGAGAAAAACGGG - Intergenic
1003227726 6:4221750-4221772 GAATATTTAAAGGGAAAAAAGGG - Intergenic
1003558032 6:7158103-7158125 GATTCTTGAATGTGAAGAAATGG - Intronic
1003903052 6:10673097-10673119 GAATGTTTAGTGGGAAAAAAGGG - Intronic
1004191520 6:13468025-13468047 GACAATAAGATGGGAAAAAATGG - Intronic
1004206947 6:13600296-13600318 GATTGTTAAATGAGAAAAGCCGG + Intronic
1004413532 6:15403571-15403593 GTTTCTGAAATAGGAAAAAAAGG + Intronic
1005020108 6:21409585-21409607 GATGATTAAATGAGATAAAATGG + Intergenic
1005034696 6:21544868-21544890 GAATATCGAATGGGAAAAAATGG - Intergenic
1007153821 6:39723154-39723176 GATTATTAGAGGAGAGAAAATGG + Intronic
1008006055 6:46410438-46410460 GATTAGGACATGGTAAAAAAAGG + Intronic
1008244391 6:49151806-49151828 GATTAACAGTTGGGAAAAAAAGG - Intergenic
1008629515 6:53349585-53349607 GATTGTTAAATGAGGAAAGATGG + Intergenic
1008659342 6:53650474-53650496 CCATATTAAATGGGAAACAATGG + Exonic
1008851608 6:56028915-56028937 GTTTACTAAATGGAAATAAATGG - Intergenic
1008895076 6:56543169-56543191 GAATACTAAATGGGAAAAGGGGG + Intronic
1008980386 6:57476528-57476550 CATTAATAAATAGGAAAGAATGG - Intronic
1009893385 6:69716533-69716555 ATTTATTAAATGAGAAAAAAAGG + Intronic
1010129932 6:72479649-72479671 TTTTTTTAAGTGGGAAAAAAGGG - Intergenic
1010249156 6:73690761-73690783 AATAATTAAATGGGAAAAGTAGG + Intergenic
1010446396 6:75953590-75953612 AATAATAAAAAGGGAAAAAAAGG - Intronic
1010771952 6:79842072-79842094 GCTTAATCAATGTGAAAAAATGG + Intergenic
1010954010 6:82069814-82069836 GTTTTTTAATTGGGAAAAATGGG + Intergenic
1011383495 6:86768276-86768298 GAGTAGAAAAGGGGAAAAAAGGG + Intergenic
1011400625 6:86957763-86957785 TATTGTTAAATGGAAAAAAAGGG + Intronic
1011409401 6:87051632-87051654 GATTATAAAATGTCAATAAATGG + Intergenic
1011551663 6:88536072-88536094 AATTATTAGGTGGGAAAAATGGG + Intergenic
1011605653 6:89102729-89102751 AATTATTAAAATGTAAAAAAAGG - Intronic
1011673100 6:89703295-89703317 GGTAATTTAATGGCAAAAAATGG - Intronic
1012444690 6:99296007-99296029 CATTAGGAAATGGGAAAGAAAGG - Intronic
1012752599 6:103183128-103183150 GACTCTTAAATGAGAAAAGAAGG - Intergenic
1013507995 6:110818277-110818299 GATTTTTAAAGGCAAAAAAAGGG + Intronic
1013576161 6:111484457-111484479 GGCTATTAAATTGGAAACAAGGG + Intergenic
1014178150 6:118352473-118352495 GTTTTTTTAAGGGGAAAAAAGGG - Intergenic
1014314729 6:119849344-119849366 GCTCATCAAATGTGAAAAAATGG - Intergenic
1014520550 6:122437580-122437602 GATTATTATATGGAAAAACTGGG + Intergenic
1014779985 6:125553537-125553559 AATTATTTAATTGAAAAAAATGG - Intergenic
1014940285 6:127430230-127430252 GAATAAGAAATGGGAAAAAGAGG + Intergenic
1015134104 6:129848219-129848241 GATTTTTAAAAAGGAATAAAAGG + Intronic
1015145844 6:129985847-129985869 CATTATTAACTGGAAAAAAATGG - Intergenic
1015244982 6:131064968-131064990 GATGATTAAAGGTGATAAAAAGG + Intergenic
1015797733 6:137029960-137029982 AATGATTAAATGGTAAATAATGG + Intronic
1015858548 6:137651914-137651936 AATTCTTAAATGAAAAAAAAAGG + Intergenic
1015965121 6:138690436-138690458 GATTATTAAAAAAAAAAAAATGG + Intronic
1016096909 6:140049434-140049456 CATTAGTAAATGGGGAAAATTGG + Intergenic
1016163938 6:140916615-140916637 GATTGATTAATAGGAAAAAAAGG - Intergenic
1016347374 6:143128989-143129011 GTTTAGAAAATAGGAAAAAATGG + Intronic
1016432450 6:144001354-144001376 AATAAATCAATGGGAAAAAAGGG + Intronic
1016715534 6:147223477-147223499 GATTATTCAATTAGAAAAAAAGG + Intronic
1016829129 6:148416334-148416356 GATTATTAAATAGGATACAGAGG - Intronic
1017613634 6:156219110-156219132 TATTATTAAATAAGAAAAGAAGG + Intergenic
1018069253 6:160147579-160147601 TATTGTTAAAAGGAAAAAAATGG - Intronic
1018275240 6:162123307-162123329 CATTATACAATGGGAAAAAAAGG + Intronic
1018496923 6:164357891-164357913 GATTACAAAATGGGGAAAATGGG + Intergenic
1018532382 6:164781507-164781529 GTATATAGAATGGGAAAAAATGG + Intergenic
1018607632 6:165614736-165614758 GCTGATTAAATGGCACAAAATGG + Intronic
1018657064 6:166047437-166047459 GATTTCTAAATTGAAAAAAATGG - Intergenic
1020439932 7:8206462-8206484 GTTTCTTAAATTGGCAAAAATGG - Intronic
1020574602 7:9910495-9910517 AATTATAAAAAGAGAAAAAAGGG - Intergenic
1020907340 7:14079858-14079880 CATTATTAATTGAAAAAAAATGG + Intergenic
1021159937 7:17260186-17260208 AAGTTTTAAATGGGAAAAAAGGG + Intergenic
1021251586 7:18334028-18334050 GATTTTGAAAAGGGAAAAACTGG + Intronic
1021576261 7:22108712-22108734 GACTCTTGCATGGGAAAAAAGGG + Intergenic
1021791703 7:24212506-24212528 TCTTATTAAATGGAAAACAATGG + Intergenic
1021805429 7:24350044-24350066 AAATACTAAATGGGATAAAAAGG + Intergenic
1021920285 7:25477971-25477993 GATAATGAAATGGGAACTAAAGG + Intergenic
1022394029 7:29969689-29969711 GATCATTAAATGAGGAAAGAAGG - Intronic
1022957828 7:35397772-35397794 GGTTAGTAAATAGGAGAAAAGGG + Intergenic
1022978739 7:35582443-35582465 GATTTTTTAATGTGAAAAAAAGG + Intergenic
1023708902 7:42970879-42970901 AATATTTAAAGGGGAAAAAATGG - Intergenic
1024444860 7:49465432-49465454 GATTATAAAATGGGAAAACCTGG - Intergenic
1024861313 7:53845364-53845386 GATCAATCAATGGGAAAAACAGG - Intergenic
1026398082 7:69979220-69979242 GTTTATCAAATGAGAATAAAAGG - Intronic
1026475850 7:70734506-70734528 GATTTTTAACTGAGAGAAAAAGG - Intronic
1026880935 7:73906190-73906212 CATTTTTAAATGAGAGAAAATGG - Intergenic
1027006570 7:74698785-74698807 GATTAATAAATGTTAAAGAATGG + Intronic
1027472195 7:78587261-78587283 TATTATCAAAAGAGAAAAAAAGG - Intronic
1027759951 7:82264905-82264927 GAGTCTGAAATGGGAAACAATGG - Intronic
1028009259 7:85619837-85619859 GATCATTAAATGGAGAAATAAGG - Intergenic
1028408884 7:90506449-90506471 AATTTTTAAAAGGGAAAAAATGG - Intronic
1028653875 7:93180325-93180347 GCTTATTAATTCTGAAAAAATGG + Intergenic
1029104882 7:98167103-98167125 GATTATTAAATGGAAATGATAGG + Intronic
1029919123 7:104243527-104243549 GATTTATACATGGGCAAAAATGG - Intergenic
1030265647 7:107618199-107618221 AATAATTAAATGTGAAAAAAAGG - Intronic
1030465516 7:109898370-109898392 GATTATGAAAGGGCAAAAATGGG - Intergenic
1031105437 7:117535948-117535970 GATTATAAAACAGGTAAAAAAGG + Intronic
1031406021 7:121388387-121388409 CATTTTGAAAAGGGAAAAAAAGG + Intronic
1031714189 7:125086719-125086741 GAATATTATATGTGAGAAAATGG + Intergenic
1031723515 7:125207332-125207354 GGTTATTAAAAGGGGAAGAATGG + Intergenic
1031845464 7:126800398-126800420 AATATTTAAATGGGAAAAATGGG - Intronic
1032318467 7:130862553-130862575 TAATATTAAATGGGAAAAAATGG + Intergenic
1032977485 7:137242148-137242170 GATTATTAAATGGGAAAAAAGGG - Intronic
1033211002 7:139460189-139460211 GATTTTTACATGGGAAAAATGGG + Intronic
1033796132 7:144847623-144847645 GACTATTAAAAGGGGAAGAAGGG - Intergenic
1033830578 7:145246770-145246792 AGTTAATAAATGGGAGAAAAAGG - Intergenic
1033897103 7:146086430-146086452 CATAATTAAATGGGAGTAAAAGG + Intergenic
1034196880 7:149254818-149254840 GATTATAAAACAAGAAAAAATGG - Exonic
1035652696 8:1280815-1280837 GATTCTTAAATGGGACACATAGG + Intergenic
1035941066 8:3901694-3901716 GATTTTGAAATGGCAAAGAATGG + Intronic
1036081310 8:5559247-5559269 GATAAATACATGAGAAAAAATGG + Intergenic
1036886354 8:12556890-12556912 GATCATTATATGGTAATAAAGGG + Intergenic
1037201865 8:16264443-16264465 CAATATTTAAAGGGAAAAAACGG + Intronic
1037202342 8:16272052-16272074 TTTTAATAAACGGGAAAAAATGG - Intronic
1038559793 8:28563780-28563802 TACTATTACATGGGAAAAGATGG - Exonic
1038572451 8:28674664-28674686 GAGCATTAATTGGGAAAGAATGG + Intronic
1038609816 8:29050027-29050049 GAGTCCTAAATGGGAAAAAATGG - Intronic
1038783431 8:30588817-30588839 AAGTCTTAAATGGGTAAAAAGGG - Intronic
1039199445 8:35072769-35072791 GATTTTTAAATGAGAAAACTTGG - Intergenic
1039212572 8:35234538-35234560 GATTCTTAAAGGCAAAAAAAAGG - Intergenic
1040997614 8:53417995-53418017 GATTGGTTAATAGGAAAAAAAGG - Intergenic
1041589696 8:59563214-59563236 CATTATTAACTGGAGAAAAATGG - Intergenic
1041752478 8:61276013-61276035 AAGCATTAAAGGGGAAAAAAAGG + Intronic
1041826128 8:62097829-62097851 TATAATCAAATGGGAACAAAAGG + Intergenic
1041962809 8:63638355-63638377 AATAAATAAGTGGGAAAAAAGGG + Intergenic
1042468374 8:69154606-69154628 GATTTATAAAGGGGGAAAAAAGG - Intergenic
1042524436 8:69749653-69749675 AATTATTGAATGAGAAAAAGAGG - Intronic
1042642554 8:70952095-70952117 CATTATAAAATGAAAAAAAAAGG + Intergenic
1043027025 8:75082957-75082979 GATTCTTAAATTGGCTAAAATGG - Intergenic
1043162790 8:76867445-76867467 GATTATTAAAAGTTAAATAACGG + Intergenic
1043262739 8:78222245-78222267 GATCATTAAATATGAAAGAAGGG + Intergenic
1043286599 8:78539639-78539661 CATTTTTAAAAGGTAAAAAAAGG + Intronic
1043494511 8:80785505-80785527 GATAAATAAAGAGGAAAAAATGG - Intronic
1043513922 8:80978432-80978454 GATTATAAAAAGGTAAACAATGG + Intronic
1043542724 8:81281061-81281083 GATGAGTAAAGGGGGAAAAAAGG - Intronic
1043742551 8:83832436-83832458 TCATATTAAATGGGAAAAACTGG - Intergenic
1043965606 8:86471324-86471346 GGTCATCAAATGGGAAGAAAGGG - Intronic
1044815850 8:96111474-96111496 TATGATGAAAAGGGAAAAAAAGG + Intergenic
1045512218 8:102820847-102820869 CATTTTTAAATGTTAAAAAAGGG - Intergenic
1045769008 8:105712095-105712117 GATTGTTAACTGGGGGAAAAAGG + Intronic
1045781794 8:105874100-105874122 GATTAATAAATGAGAAGCAAAGG + Intergenic
1046730835 8:117724443-117724465 GATTATTTAGGGGAAAAAAAAGG + Intergenic
1046937096 8:119895062-119895084 GATTATCAAATGGGACATAGGGG - Intronic
1047792163 8:128214650-128214672 AATTTTTAAATGAAAAAAAAAGG - Intergenic
1047945464 8:129873400-129873422 GACTATTACATTGGAAAATATGG - Intronic
1048054449 8:130850044-130850066 AATTAATAAGAGGGAAAAAATGG - Intronic
1048750942 8:137674740-137674762 AATTGTGAAATGGGAATAAAAGG + Intergenic
1049870086 8:144968041-144968063 GATTTTTAAAGGGAAAAAAGAGG - Intergenic
1050709123 9:8440099-8440121 GATTTCTAAATGGGAAAAAAAGG - Intronic
1051217078 9:14809449-14809471 CATTTTTAAACGGGAAATAATGG - Intronic
1051975000 9:22938586-22938608 GATTGATTAATAGGAAAAAAAGG + Intergenic
1052062643 9:23979623-23979645 GATAATAAAATGGGAAAATAAGG + Intergenic
1052403063 9:28025157-28025179 GAGTGTTTAAGGGGAAAAAAGGG - Intronic
1052452171 9:28645192-28645214 GTTAATTAATTGGAAAAAAAGGG + Intronic
1053947703 9:43329854-43329876 CATTATTGAATGGAATAAAATGG - Intergenic
1053947796 9:43331059-43331081 CATCATTAAATGGAATAAAATGG - Intergenic
1055001937 9:71460901-71460923 TATTATAAAATGGGAAACAACGG - Intergenic
1055172368 9:73274715-73274737 TATAAGTCAATGGGAAAAAATGG - Intergenic
1055893470 9:81147933-81147955 GTTTGTAAAATGGGAAAATAAGG - Intergenic
1056268402 9:84922810-84922832 GATGATTAAATGGTAAATGAAGG + Intronic
1056374717 9:85996475-85996497 AATAATTAAAAGGGAAGAAATGG + Exonic
1057229867 9:93314685-93314707 CATTATTAATTGACAAAAAATGG + Intronic
1057890501 9:98866568-98866590 GATTTTTATGAGGGAAAAAAAGG - Intergenic
1058175129 9:101726643-101726665 AATTTTTAAATGGGAACATATGG - Intronic
1058231277 9:102429125-102429147 TTCTATTAAATGGAAAAAAATGG - Intergenic
1058264004 9:102874659-102874681 GATTAGTCAATGGGAATAATGGG + Intergenic
1058295230 9:103298204-103298226 GATTAATAATTGGAAAGAAAGGG + Intergenic
1058354825 9:104072266-104072288 GATTATAGAAAGGGAAAATAGGG + Intergenic
1059616389 9:115956042-115956064 AAATATTAAATGGGAAAAGAAGG + Intergenic
1060457489 9:123812382-123812404 GATCATCAACAGGGAAAAAATGG - Intronic
1061021334 9:128017081-128017103 AATAAATAAATGGGAAAAAAGGG + Intergenic
1061643177 9:131976197-131976219 GGTAATTATAAGGGAAAAAATGG + Intronic
1203405167 Un_KI270528v1:1134-1156 GATCATTAAATGGAATCAAATGG - Intergenic
1203590833 Un_KI270747v1:58412-58434 CATTATTGAATGGAATAAAATGG - Intergenic
1203590926 Un_KI270747v1:59617-59639 CATCATTAAATGGAATAAAATGG - Intergenic
1185695347 X:2189873-2189895 GAATCTTAGATGGGAAAATAAGG + Intergenic
1186337913 X:8610963-8610985 GCACATAAAATGGGAAAAAAGGG + Intronic
1187600756 X:20827013-20827035 ATTTGTTAAATGGGAAAATAAGG - Intergenic
1187825307 X:23329951-23329973 AAATATTTCATGGGAAAAAATGG + Intergenic
1187916316 X:24155778-24155800 GATAAATACATGGGGAAAAAAGG - Intronic
1188413691 X:29905650-29905672 GATTCTTATATTTGAAAAAAAGG + Intronic
1188458765 X:30397718-30397740 CATTATTAAATGACAAAAACTGG + Intergenic
1188945893 X:36301401-36301423 GATTATTACAAGGGATAAAAAGG + Intronic
1188960172 X:36481782-36481804 GAGTTTTAAAAGGGGAAAAAGGG - Intergenic
1189400702 X:40665854-40665876 CATTTTTAATTGTGAAAAAATGG + Intronic
1189842541 X:45096029-45096051 GATGATTCAAAGGAAAAAAAGGG - Intronic
1189844265 X:45118044-45118066 GATTATTTAATAGGAATAACTGG - Intergenic
1190600531 X:52088376-52088398 GACTATTAAAAGAAAAAAAAAGG - Intergenic
1190682791 X:52842703-52842725 GATTATTACAAGGGACAAAGTGG + Intergenic
1191821883 X:65319182-65319204 GATTAATAAAGGGAAAAAAGAGG + Intergenic
1192095852 X:68209860-68209882 GATTATTCTTTTGGAAAAAAGGG - Intronic
1193479428 X:82009731-82009753 GTTTATTAACTGGGCTAAAATGG - Intergenic
1193551147 X:82894141-82894163 GGTTATTAACTGGGCTAAAATGG - Intergenic
1193756317 X:85413330-85413352 TCATATTGAATGGGAAAAAATGG - Intergenic
1194053301 X:89100020-89100042 GATTCTTAAGAGGGAAAAACAGG - Intergenic
1194171608 X:90591889-90591911 GAATATTAAAGGTGAAAAAAAGG - Intergenic
1194431847 X:93817565-93817587 GTATATTGAATGGGAAAAAATGG + Intergenic
1194777815 X:97987184-97987206 GATCATTAAATGAAACAAAAAGG + Intergenic
1195580739 X:106498568-106498590 GACAATTCAATGGGAGAAAAGGG - Intergenic
1195901079 X:109797916-109797938 ATTTATTTAATTGGAAAAAAAGG - Intergenic
1196020035 X:110981846-110981868 GAATTTGAAGTGGGAAAAAAGGG + Intronic
1196121639 X:112057625-112057647 GATGATTGAATGGGGTAAAAGGG - Intronic
1196128960 X:112131961-112131983 GTTTATAAAATGGGAATAATAGG - Intergenic
1196245706 X:113396886-113396908 GATCCTCAAATGGAAAAAAATGG - Intergenic
1196962221 X:121015274-121015296 GATAACCATATGGGAAAAAATGG + Intergenic
1196975052 X:121150179-121150201 GATTATTTAGTGGAAAAACAGGG - Intergenic
1197139992 X:123107140-123107162 GAATATGATGTGGGAAAAAAGGG - Intergenic
1197161402 X:123326788-123326810 AGTTATAAAATGGGAAAAAATGG - Intronic
1197481383 X:126990992-126991014 GATTATCAATTAGGAAAAATGGG - Intergenic
1198522212 X:137464562-137464584 GGTTACTAAATGGAAAAAGAAGG - Intergenic
1198751590 X:139941283-139941305 AATTAATAAATGAGAATAAATGG + Intronic
1199344832 X:146726564-146726586 GAATATTAAATGAGATAAAATGG - Intergenic
1199449164 X:147960004-147960026 GATTATTATGTGGGGAGAAAGGG + Intergenic
1199670604 X:150145158-150145180 AATTATTAAAGCAGAAAAAAAGG + Intergenic
1199918218 X:152368134-152368156 GCTTTTGAAATGGGAAGAAATGG - Intronic
1200837549 Y:7747956-7747978 GATTTTTTCATGGGAAAAATAGG + Intergenic
1201180130 Y:11334930-11334952 CATAATTAAAAGGGAAAAAACGG + Intergenic
1201308821 Y:12575916-12575938 GATTATAAAAGGTTAAAAAAAGG + Intergenic
1201336207 Y:12882717-12882739 CATTATTCAATGGGAAGTAACGG - Intergenic
1201563979 Y:15347011-15347033 GATTATCAGATCGGAAAAGAGGG + Intergenic