ID: 1032985004

View in Genome Browser
Species Human (GRCh38)
Location 7:137328132-137328154
Sequence GGGTCTTTAATCTGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032985004 Original CRISPR GGGTCTTTAATCTGGCAGCA TGG (reversed) Intronic
902606246 1:17570947-17570969 GGTTCTTTGTTCTGGCAGCATGG + Intronic
907611769 1:55878330-55878352 GGGTCTCTATTCAGGCAGCATGG + Intergenic
908023055 1:59917980-59918002 TGGACTTTAATGTGGGAGCAAGG - Intronic
909195124 1:72610572-72610594 GGGTCTCTAATCTGACATTACGG + Intergenic
909642500 1:77884190-77884212 GGGCCTTTGATCTGGAAGAATGG - Intergenic
913492775 1:119397060-119397082 AGGTCTTTAATCTGGCAGCCAGG + Intergenic
913503303 1:119491777-119491799 AGGTCTTTGATATGGCAGCAAGG + Intergenic
913514365 1:119590477-119590499 GGGCCTTTAATCCAGCAGCAAGG + Intergenic
916005833 1:160659167-160659189 GGGACTTGACTCTGGAAGCAGGG - Intergenic
919709874 1:200715728-200715750 TGGTCTTTCATCTGGAAGCATGG - Intergenic
923529194 1:234800175-234800197 GGGTGTTGAATTTGCCAGCACGG + Intergenic
1063681062 10:8188450-8188472 AGGTCTTTAATCTCAGAGCAAGG + Intergenic
1064436234 10:15313422-15313444 TGGTCTTAACTCTGGCACCAAGG + Intronic
1067161246 10:43826484-43826506 GGGTTTGTCACCTGGCAGCATGG - Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1072801989 10:98398579-98398601 AGGCCTTTAATATGACAGCATGG + Intronic
1073258602 10:102171837-102171859 CGGTCTTTAATAAGGCAGTAGGG + Intergenic
1073534700 10:104266426-104266448 GGGTTTTTAATCAGGAAGGAAGG - Intronic
1076777230 10:132704574-132704596 GGGACTTGAACCTGGCAGCCTGG + Intronic
1077603100 11:3587648-3587670 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
1078566354 11:12417925-12417947 GGGTCTCTAATCTGGAGGAAAGG - Intronic
1082717557 11:56633426-56633448 GGATCTTCAAGATGGCAGCAAGG + Intergenic
1083068368 11:59949353-59949375 TGGTCCTTAATATGGCATCAGGG + Intergenic
1084258986 11:67962186-67962208 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
1084813767 11:71632989-71633011 GGGTCTTTTACCTGGAAGAAAGG + Intergenic
1088440060 11:109860359-109860381 CGGTCTTTTATGCGGCAGCAGGG - Intergenic
1089267306 11:117273985-117274007 GGAACTTTAATCTCGTAGCAGGG + Intronic
1092043622 12:5407789-5407811 GCATCCTTAATCTGGCCGCATGG + Intergenic
1092352640 12:7768433-7768455 TGGTCTTTAATGTGGCAACTTGG + Intronic
1102641444 12:114370697-114370719 GGGGCTTTAATCTCACAGGATGG - Intronic
1104881909 12:132077628-132077650 GTGTCTTTAGCCTGACAGCAGGG - Exonic
1108468417 13:50742667-50742689 GGGTCATTGTTCTGGTAGCAGGG + Intronic
1109532283 13:63665251-63665273 GGGTCTGTAGTCTAGCAGGAAGG + Intergenic
1114353528 14:21881533-21881555 GGGTTTTGAGTCTGGGAGCAAGG - Intergenic
1118320841 14:64752453-64752475 GGATCTTTCCTCTGGCAGAAAGG + Intronic
1119134999 14:72209604-72209626 GGGACAATAAGCTGGCAGCATGG - Intronic
1120328080 14:83054274-83054296 GGATGTGAAATCTGGCAGCAGGG - Intergenic
1121595995 14:95162795-95162817 GGGTGTTTGAGCTGGCACCATGG + Intergenic
1121798484 14:96754777-96754799 GATTCTTTGCTCTGGCAGCAGGG - Intergenic
1127143220 15:55998139-55998161 GGGTCTTTAATCTGTCAGTCTGG - Intergenic
1128068165 15:64776664-64776686 GGGTTTCTACTGTGGCAGCAGGG - Intergenic
1128610031 15:69065850-69065872 CTGTCTTTAATCTGAAAGCAAGG + Intergenic
1129271045 15:74419392-74419414 GGGCCTTTCAGCAGGCAGCAGGG + Intronic
1132061259 15:98694061-98694083 GTGTCCTTTATCTGGTAGCAAGG + Intronic
1133365880 16:5209676-5209698 GGGTCTTGTACCTGGCAGAAAGG + Intergenic
1133996619 16:10753335-10753357 GGGTCTGTACCCTGGAAGCAAGG + Intronic
1134243132 16:12520402-12520424 GGGCCTTCCATCAGGCAGCAGGG - Intronic
1138130324 16:54473819-54473841 AGGCCTTTAATCTGGTAGAAGGG + Intergenic
1139777418 16:69325096-69325118 GGGTCTTTTAATTGGAAGCAAGG - Exonic
1142887449 17:2921600-2921622 GGGTCGTTAAGGTGTCAGCAGGG + Intronic
1142887452 17:2921620-2921642 GGGTCGTTAAGGTGTCAGCAGGG + Intronic
1148564649 17:48625811-48625833 GGGTCTTTGATTAGACAGCACGG + Exonic
1149063517 17:52453066-52453088 GGGTCTTCAGTGTGGCTGCAGGG + Intergenic
1150614057 17:66755302-66755324 GGGCTTTTGATCTGGCAGAAAGG - Intronic
1152213979 17:79021666-79021688 GGGTCTCTTATCTGGAACCAAGG - Intergenic
1153541583 18:6161231-6161253 GAGAGCTTAATCTGGCAGCAGGG + Intronic
1154346786 18:13549235-13549257 GGGCATTTAAACTGCCAGCAGGG - Intronic
1155177142 18:23310679-23310701 GGGTCTCCAAGCTGGGAGCAAGG + Intronic
1155553360 18:26990991-26991013 GGGGCTGAGATCTGGCAGCATGG + Intronic
1157676496 18:49572507-49572529 GGATCTGGAATCTGACAGCATGG - Intronic
928666524 2:33555376-33555398 GGTTCTTCTATCTGGCAGGAAGG + Intronic
929721203 2:44370082-44370104 GGGTCTGTAGTCAGGCAGCCTGG + Intronic
930880161 2:56261387-56261409 GAGTGTTTAAAATGGCAGCAGGG - Intronic
932907626 2:75770547-75770569 GGTTCTTGATTCTGGCAGGATGG + Intergenic
945884769 2:215363556-215363578 GGAAAATTAATCTGGCAGCAGGG - Intronic
947241287 2:227997090-227997112 GGTACTTTAATCTGGCACCAGGG - Intronic
1176013293 20:62912243-62912265 GGGTCATTCACTTGGCAGCAGGG - Intronic
1183310424 22:37106719-37106741 GGGTCTTGGATGTCGCAGCAAGG - Intronic
1185220156 22:49625149-49625171 GGGTCCTAAATGTGGGAGCAGGG - Intronic
949300658 3:2580252-2580274 GGGTCTGTCTCCTGGCAGCAAGG + Intronic
952471724 3:33661129-33661151 TGGTCTTTCACTTGGCAGCAGGG + Intronic
952969341 3:38641116-38641138 GTGCCTTTGATCTGGGAGCAAGG - Intronic
954628548 3:52035997-52036019 GTATCTTTCCTCTGGCAGCAGGG - Intergenic
957073935 3:75586715-75586737 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
957452654 3:80399981-80400003 GGGTCTTTCATCAGGCACCACGG + Intergenic
961280150 3:125760014-125760036 GGGTCTTGTACCTGGCAGAAAGG + Intergenic
961874253 3:130009558-130009580 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
962916420 3:139908274-139908296 GATTTTTTAATTTGGCAGCATGG - Intergenic
966659586 3:182399405-182399427 GGGACTTTATTCTGGCATCCTGG + Intergenic
969017518 4:4114022-4114044 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
969736425 4:8994289-8994311 GGGTCTTTTACCTTGCAGAAAGG + Intergenic
978265278 4:106816306-106816328 AGGTCTTTAGTTTGGCAGAATGG - Intergenic
980647754 4:135665258-135665280 TGCTCTTTAATATGGCAACATGG - Intergenic
984311734 4:178069608-178069630 GGCTCTTTAGTTTGGCAGTAAGG - Intergenic
984471625 4:180183055-180183077 GGGTCTTCAATTTAGTAGCAGGG + Intergenic
986354459 5:6910066-6910088 GGCTCTTCCATCTGGCAGCACGG - Intergenic
988995230 5:36708614-36708636 GGGTCACTACTCTGTCAGCAGGG - Intergenic
990513575 5:56511548-56511570 GTGTCTTAAATCTGCCAGAATGG + Exonic
992402426 5:76423995-76424017 AGCTCTTTAATCAGGCAGGATGG + Intronic
993885841 5:93413983-93414005 CTGGCTTTAATCTGGCAGGAAGG - Intergenic
996978364 5:129460926-129460948 GGGTCTGTAATCTGATCGCAAGG + Intronic
999461108 5:151758342-151758364 GGGAGTTTAATCTGGGAGCCAGG - Intronic
1000278896 5:159764955-159764977 TGGTGTTTTATGTGGCAGCAGGG + Intergenic
1007936331 6:45735986-45736008 TGGTCTTTAATCTGGCATCCAGG + Intergenic
1008041786 6:46809320-46809342 GTGGATTTAATGTGGCAGCATGG + Intronic
1008827206 6:55710928-55710950 GGCTTTTTAATCTGGCAGTCTGG + Intergenic
1010912686 6:81579165-81579187 GTGTCTTTAATCTGTCAGACAGG - Intronic
1012966261 6:105677026-105677048 GAGTGTTTAATTTGGCAACATGG - Intergenic
1014631297 6:123793547-123793569 GTGTCTTTGAGCTGCCAGCATGG + Intergenic
1016038606 6:139409165-139409187 GGTTCTTTTGTCTGGCAGCCAGG - Intergenic
1016371243 6:143376058-143376080 GGGTCTTTATTCTGTCTTCATGG + Intergenic
1023390557 7:39707234-39707256 AAGTTTTTAATCTGGGAGCAGGG + Exonic
1027552040 7:79610834-79610856 GGGCCATTAACCTGGCAACAAGG - Intergenic
1029538244 7:101168320-101168342 GGGTCTTGACTCTGTCTGCATGG + Intergenic
1031819167 7:126477305-126477327 GGAGATTTAATGTGGCAGCATGG + Intronic
1032985004 7:137328132-137328154 GGGTCTTTAATCTGGCAGCATGG - Intronic
1035363063 7:158326106-158326128 AGGTCTTGAGTCTGGCAGCCAGG + Intronic
1036241510 8:7085496-7085518 GGGTCTTGTACCTGGCAGAAAGG + Intergenic
1036260331 8:7234620-7234642 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
1036306285 8:7604903-7604925 GGGTCTTGTACCTGGCAGAAAGG + Intergenic
1036312368 8:7693176-7693198 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
1036357130 8:8052888-8052910 GGGTCTTGTACCTGGCAGAAAGG + Intergenic
1036901441 8:12672369-12672391 GGGTCTTGTACCTGGCAGAAAGG - Intergenic
1036908897 8:12735235-12735257 TGGTCTTAAGTTTGGCAGCATGG - Intronic
1041121780 8:54593216-54593238 TGATCTTTAATCTGCCATCAAGG + Intergenic
1043222640 8:77686727-77686749 AGGTCTTTAAAATGGCATCAGGG - Intergenic
1044712947 8:95074391-95074413 TGGTCTTTAATCTGGGGCCAGGG + Intronic
1045502340 8:102753167-102753189 GGCTCTTTAACCTCTCAGCAAGG - Intergenic
1049108159 8:140626348-140626370 GGGTCTTTACTTTGCAAGCAGGG - Intronic
1050511094 9:6396642-6396664 GGGTCTTTAATGAGGTAACAAGG + Intergenic
1058292415 9:103258472-103258494 GGATCTGTGAGCTGGCAGCAAGG + Intergenic
1059314559 9:113412901-113412923 GGGTATTTTATCTGCCTGCATGG + Intronic
1060389271 9:123265986-123266008 GGGTCAGTATTCAGGCAGCATGG - Intronic
1060465490 9:123901083-123901105 TGGATTTTAATCTGGAAGCATGG + Intronic
1199907057 X:152243499-152243521 GGGTTTTAAATCTGGCAGTCTGG - Intronic