ID: 1032987280

View in Genome Browser
Species Human (GRCh38)
Location 7:137352116-137352138
Sequence GCTTCAGGACTAGCTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032987278_1032987280 -9 Left 1032987278 7:137352102-137352124 CCCTCTGAGATTCTGCTTCAGGA No data
Right 1032987280 7:137352116-137352138 GCTTCAGGACTAGCTCATCCAGG No data
1032987279_1032987280 -10 Left 1032987279 7:137352103-137352125 CCTCTGAGATTCTGCTTCAGGAC No data
Right 1032987280 7:137352116-137352138 GCTTCAGGACTAGCTCATCCAGG No data
1032987275_1032987280 4 Left 1032987275 7:137352089-137352111 CCTGGCCAGTCAGCCCTCTGAGA No data
Right 1032987280 7:137352116-137352138 GCTTCAGGACTAGCTCATCCAGG No data
1032987276_1032987280 -1 Left 1032987276 7:137352094-137352116 CCAGTCAGCCCTCTGAGATTCTG No data
Right 1032987280 7:137352116-137352138 GCTTCAGGACTAGCTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032987280 Original CRISPR GCTTCAGGACTAGCTCATCC AGG Intergenic
No off target data available for this crispr