ID: 1032987903

View in Genome Browser
Species Human (GRCh38)
Location 7:137359277-137359299
Sequence CTGGATACATAGATATAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032987903_1032987906 4 Left 1032987903 7:137359277-137359299 CCTGGTTATATCTATGTATCCAG No data
Right 1032987906 7:137359304-137359326 CTTGTTCATCATTTTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032987903 Original CRISPR CTGGATACATAGATATAACC AGG (reversed) Intergenic
No off target data available for this crispr