ID: 1032987906

View in Genome Browser
Species Human (GRCh38)
Location 7:137359304-137359326
Sequence CTTGTTCATCATTTTTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032987900_1032987906 27 Left 1032987900 7:137359254-137359276 CCAGATATAGTTGGGATCAGTGC 0: 2
1: 1
2: 9
3: 28
4: 198
Right 1032987906 7:137359304-137359326 CTTGTTCATCATTTTTTGAATGG No data
1032987903_1032987906 4 Left 1032987903 7:137359277-137359299 CCTGGTTATATCTATGTATCCAG No data
Right 1032987906 7:137359304-137359326 CTTGTTCATCATTTTTTGAATGG No data
1032987902_1032987906 5 Left 1032987902 7:137359276-137359298 CCCTGGTTATATCTATGTATCCA No data
Right 1032987906 7:137359304-137359326 CTTGTTCATCATTTTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032987906 Original CRISPR CTTGTTCATCATTTTTTGAA TGG Intergenic
No off target data available for this crispr