ID: 1032989098

View in Genome Browser
Species Human (GRCh38)
Location 7:137371221-137371243
Sequence TACAGGACATTAATATCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032989090_1032989098 24 Left 1032989090 7:137371174-137371196 CCAGTGACAAGCAAAAGGGACAA No data
Right 1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG No data
1032989089_1032989098 25 Left 1032989089 7:137371173-137371195 CCCAGTGACAAGCAAAAGGGACA No data
Right 1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG No data
1032989094_1032989098 0 Left 1032989094 7:137371198-137371220 CCAAAGTCAGTGTGAGGGGACTA No data
Right 1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG No data
1032989088_1032989098 26 Left 1032989088 7:137371172-137371194 CCCCAGTGACAAGCAAAAGGGAC No data
Right 1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032989098 Original CRISPR TACAGGACATTAATATCAAG GGG Intergenic
No off target data available for this crispr