ID: 1032991052

View in Genome Browser
Species Human (GRCh38)
Location 7:137395484-137395506
Sequence CTGTGCTTATGGAAGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032991052_1032991056 -3 Left 1032991052 7:137395484-137395506 CCCAGGCACTTCCATAAGCACAG 0: 1
1: 0
2: 3
3: 23
4: 161
Right 1032991056 7:137395504-137395526 CAGAAAGGATGTCCGTGCTATGG 0: 1
1: 0
2: 0
3: 6
4: 63
1032991052_1032991058 10 Left 1032991052 7:137395484-137395506 CCCAGGCACTTCCATAAGCACAG 0: 1
1: 0
2: 3
3: 23
4: 161
Right 1032991058 7:137395517-137395539 CGTGCTATGGTCACAAGCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032991052 Original CRISPR CTGTGCTTATGGAAGTGCCT GGG (reversed) Intronic
903028529 1:20446371-20446393 CTGGGGTGATGGAAGTGACTGGG + Intergenic
903185028 1:21623977-21623999 CTGTGTGTATGGGAATGCCTTGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905228979 1:36500573-36500595 CTGTCCTCATGGAAGGGGCTGGG + Intergenic
905915603 1:41682317-41682339 CTGTGCTTATGGCATTGCTGTGG + Intronic
909805453 1:79869134-79869156 CTGTTCTTTTGCAATTGCCTAGG - Intergenic
910108151 1:83653594-83653616 CTGTGCTGATTCCAGTGCCTCGG - Intergenic
910858947 1:91724692-91724714 CTGTACTTCTGGAAGTCCCTAGG + Intronic
912385594 1:109269792-109269814 CTGTGCTCATGGACGTTTCTCGG + Exonic
914957278 1:152174133-152174155 ATGTGCTTATGGCAGTGGCTGGG + Intergenic
917961248 1:180146926-180146948 TTTTCCTTATGGAACTGCCTTGG - Intergenic
918960988 1:191277544-191277566 ATGTGCATATGGAGGTGCATAGG - Intergenic
920960338 1:210657833-210657855 CTACACTTGTGGAAGTGCCTGGG - Intronic
924028732 1:239865884-239865906 CTGTGCTCAGAGAAGTGCCCAGG + Intronic
1066349802 10:34626874-34626896 CTGGGCTTATGCATGTGCCTAGG - Intronic
1068857051 10:61808441-61808463 CTGTTCTTCAGGAATTGCCTTGG - Intergenic
1070445303 10:76493493-76493515 CTTTGCTTATTGAATTGCCTTGG + Intronic
1075462735 10:122629417-122629439 CTGTGCTCATGGAAGACGCTAGG + Intronic
1076293059 10:129362276-129362298 CTTTACTTATGTAAGTGCCTTGG - Intergenic
1079224912 11:18596544-18596566 CTGGGCTTGTGGTAGTGCCACGG - Intergenic
1079991725 11:27253443-27253465 CTGTGGTTTTGGCAGTGGCTGGG - Intergenic
1080210918 11:29783978-29784000 CTATGCTTAGAGCAGTGCCTGGG - Intergenic
1081785727 11:45745627-45745649 CTGTCCTTATGGAACTTTCTGGG - Intergenic
1085038665 11:73314290-73314312 CTTTGCTTCTGGCAGTCCCTGGG + Intronic
1087592515 11:100209089-100209111 CTGTGCTTCTGTAAGTGACTTGG - Intronic
1088277813 11:108107420-108107442 CTGTTCTCATGTAAGTGACTGGG + Exonic
1090816121 11:130297656-130297678 CTTTGCTTCTGGTAGTGCCTTGG - Intronic
1091011643 11:132006799-132006821 CTGTGGTTATAGAATAGCCTGGG + Intronic
1091280133 11:134376986-134377008 CAGTTCTTCTGGAACTGCCTCGG + Intronic
1092507995 12:9124427-9124449 CTGTGCTCTTGGAAGGGGCTGGG + Intergenic
1096661653 12:53129002-53129024 CTGTGGTTCGGGAAGTACCTAGG + Intergenic
1097943134 12:65334703-65334725 CTGTCCTTAGGGAAGTCCCTTGG + Intronic
1101588368 12:106104624-106104646 CAGTGCTTCTCAAAGTGCCTGGG - Intronic
1102096535 12:110245814-110245836 TTGTCCTTATGAAAGTTCCTCGG + Intergenic
1103013522 12:117476375-117476397 CAGTGCTTTTGGAAGGGCCAGGG - Intronic
1104196682 12:126546576-126546598 CTGTTCTCATGGTAGTGCGTGGG + Intergenic
1106435765 13:29721827-29721849 CTGTGAGTGTGGGAGTGCCTGGG - Intergenic
1107034693 13:35888521-35888543 CAGTACTTATGTAAGTCCCTGGG + Intronic
1110233714 13:73194274-73194296 CTGTGCTCATGTCACTGCCTGGG + Intergenic
1112033161 13:95475271-95475293 CTGTGATTATGGAAGCTCCCTGG + Intronic
1114705739 14:24725200-24725222 TTGTGCATATGGAAGCTCCTAGG + Intergenic
1114789773 14:25644475-25644497 AAGTGCTTATTGCAGTGCCTGGG + Intergenic
1115522991 14:34251853-34251875 CTTTTCTTATGAAAGTGCCAAGG + Intronic
1115931972 14:38507676-38507698 CTGTGATTTTGGCAGTGGCTTGG + Intergenic
1116827486 14:49686854-49686876 CTGTGCTTTGGGAGATGCCTTGG - Intronic
1119203940 14:72779965-72779987 CTGTGCTTAGGGCAGTCCTTGGG - Intronic
1119621331 14:76134147-76134169 CTCTGCCTGTGGAAGGGCCTTGG + Intergenic
1119668595 14:76501514-76501536 CTGTGCAGATGGAAGTGGCAGGG + Exonic
1122022527 14:98851015-98851037 CTGAGCTTCTGGTAGTTCCTGGG - Intergenic
1128575252 15:68769927-68769949 CTGTGCTGAAAGAACTGCCTGGG - Intergenic
1129881449 15:79009340-79009362 CTGGGCTGGAGGAAGTGCCTGGG + Intronic
1130881467 15:88059573-88059595 CTGTGTTGATTGAGGTGCCTGGG - Intronic
1132319535 15:100915500-100915522 TTCTGCTTAAGAAAGTGCCTTGG - Exonic
1132571746 16:647284-647306 CTCTGGTTCAGGAAGTGCCTAGG + Intronic
1137030422 16:35518791-35518813 CTGTGCTTCTGGGTGTTCCTGGG - Intergenic
1140473414 16:75227086-75227108 CTGGGCTCATGGGGGTGCCTGGG - Intergenic
1140710927 16:77676952-77676974 CAGTGCTTAATGAAGTACCTGGG - Intergenic
1141590421 16:85065203-85065225 ATGCGCTTGTGGAAGGGCCTTGG + Intronic
1143858774 17:9872720-9872742 CTGGCCTTAGGCAAGTGCCTTGG + Intronic
1144855326 17:18264304-18264326 CTGTGCTTGTGGCAGTCCCTGGG + Exonic
1146469297 17:33111414-33111436 CTGTGCCTATGTAAGCCCCTGGG - Intronic
1148360063 17:47004393-47004415 CTGTGCTGTGGGAAGTGCCAGGG - Intronic
1150409863 17:64934381-64934403 CTGTGCCTGTGGAAGTCCCTTGG - Intergenic
1150910875 17:69386204-69386226 CAGTGCTTATAGCAGTTCCTAGG - Intergenic
1151006698 17:70446215-70446237 CTGTGGTTCTGGAAATGGCTAGG + Intergenic
1151644092 17:75417777-75417799 CTGTGATCATGGCACTGCCTGGG + Intergenic
1152574122 17:81132732-81132754 CTGTGCTGAGGGAAGGGGCTGGG - Intronic
1154283553 18:13030794-13030816 CTTTGCTTAAGGAAATGGCTTGG - Intronic
1155640818 18:28011940-28011962 CTGTGCTTACTGAATTGTCTTGG + Exonic
1157497095 18:48163877-48163899 CAGTGCTTATGGCAGCTCCTGGG - Intronic
1158698161 18:59721171-59721193 CTGTGCTTATGGAATACCCCTGG - Intergenic
1159232258 18:65624182-65624204 TTGTGCGTATGGAAGTTACTGGG - Intergenic
1160886617 19:1352725-1352747 CTGTGCTTTGGGAGGTGCTTTGG - Intergenic
1161862131 19:6805890-6805912 CTGCCCTGATGGAAGTGTCTTGG + Intronic
1162475208 19:10895668-10895690 CTGTGCTTAGGGAAGAGGCTGGG + Intronic
1163602406 19:18257057-18257079 CTGGGTTAATGGAAGTGGCTTGG - Intergenic
925314922 2:2914144-2914166 CTGGGCTCATGGCAGGGCCTGGG + Intergenic
929170931 2:38932746-38932768 CTGTGATTATTTAAGTCCCTGGG - Intronic
934580590 2:95434605-95434627 CTGTTCTTGGGGAAGTGCCAAGG - Intergenic
934598859 2:95642112-95642134 CTGTTCTTGGGGAAGTGCCAAGG + Intergenic
935750992 2:106233518-106233540 GTGTGCTGATGGAAGAGCCTTGG + Intergenic
936532206 2:113284105-113284127 CTGTTCTTGGGGAAGTGCCAAGG + Intergenic
938698460 2:133855427-133855449 CTGTGCTTAGAACAGTGCCTGGG + Intergenic
939142316 2:138369606-138369628 CAGTGCTTAGAGCAGTGCCTGGG - Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
942158892 2:173161177-173161199 TTGTGCTCATGTAATTGCCTTGG + Intronic
942316427 2:174700493-174700515 CTGTGCTTATAAAAATGCCTTGG + Intergenic
944432026 2:199644427-199644449 CTGTTCTGATGGAAGTGGCAGGG + Intergenic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
947165732 2:227259948-227259970 ATGTGCTTATGGAATTGACATGG + Intronic
948931500 2:241135156-241135178 CTGTGCATATGAAAGGGACTCGG + Intronic
948972539 2:241440526-241440548 CTGTGCTTTTGGAAGGCCCCAGG + Intronic
1169194560 20:3676182-3676204 CTGTGCTCAGGAAGGTGCCTTGG - Intronic
1169895083 20:10496171-10496193 CAGTGCTTATGCATGTGTCTGGG + Intronic
1170343024 20:15350385-15350407 CTCTATTTATGGAAGTGCATCGG - Intronic
1170913947 20:20604263-20604285 CTGTGCTTAAGGATGTGGCATGG - Intronic
1170962998 20:21041960-21041982 CTGTGAGCCTGGAAGTGCCTGGG - Intergenic
1171157637 20:22890918-22890940 CTTTGTTTATGGAAGTCACTTGG - Intergenic
1173133866 20:40422041-40422063 GTGCGCTTATTAAAGTGCCTGGG - Intergenic
1173204161 20:40979674-40979696 CTCTGCTTATGGAAGTGGGAGGG - Intergenic
1174087191 20:48017857-48017879 CTGGGCTTATGGAGGGGACTGGG + Intergenic
1174261191 20:49296544-49296566 CTGGGCTTGTGGAATTGGCTGGG + Intergenic
1178109245 21:29354111-29354133 CTTTGCATATGCAATTGCCTTGG - Intronic
1178982909 21:37280196-37280218 CTGTCCCTGTGGAATTGCCTTGG - Intergenic
1179405486 21:41122186-41122208 CTGTGCTCATGAAGGTGCCCCGG + Intergenic
1181719596 22:24763717-24763739 CTGTGCTTGTGGGGATGCCTGGG - Intronic
1182558118 22:31140075-31140097 CTGTGCTCATGAGACTGCCTGGG - Exonic
1183115097 22:35685751-35685773 CTGTCCTGATGGAACAGCCTTGG + Intergenic
1183759660 22:39804729-39804751 CTGTGCTTGGGGAAGGGCCTTGG - Intronic
950430236 3:12946669-12946691 CTGTTCTTATGAAAAAGCCTTGG + Intronic
952593416 3:34985954-34985976 CTGTGCTTATACAAATGGCTTGG - Intergenic
952857560 3:37784813-37784835 CTGTGTTTATGTGGGTGCCTGGG + Intronic
953717869 3:45331336-45331358 CTGTCCTTAAGGAAATTCCTGGG + Intergenic
957598846 3:82305916-82305938 CCGTGCTTCTGAAAGTGACTAGG - Intergenic
958790721 3:98648049-98648071 CATTGCTTATGAAAGTGTCTTGG - Intergenic
960571617 3:119190400-119190422 CTGTGCATATTGGATTGCCTGGG - Intronic
961036241 3:123643957-123643979 TTGTCCTTTTGGAAGTGCTTGGG - Intronic
961354393 3:126326637-126326659 CTGTGCTTTAGGCTGTGCCTAGG + Intergenic
961918519 3:130401947-130401969 CTATGCTAATGGAATTGCTTTGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962684366 3:137832743-137832765 CTGAGCTTATGTAATTGGCTGGG + Intergenic
964189039 3:153980664-153980686 CTGTTCTGATGGAAGTGGCAGGG - Intergenic
965240237 3:166187671-166187693 CTGTGCCTATGGCATTGCCTAGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969131807 4:4995632-4995654 CTGTGCTGACGGAAGTCCCTGGG - Intergenic
969723026 4:8903695-8903717 CTCTGCTCATGGAGATGCCTCGG - Intergenic
972263239 4:37432961-37432983 CTGTGCTCTTGGAACTGCCTGGG - Intronic
978112376 4:104978163-104978185 CTGTGCTTTAGGAAGAGGCTTGG - Intergenic
986220070 5:5760742-5760764 CTCTACTTATGGAAGTCCCAAGG - Intergenic
987048289 5:14127611-14127633 CTGTCCTTTGGGAAGTTCCTTGG + Intergenic
987187326 5:15437735-15437757 CTTTCCTTATTGAATTGCCTTGG - Intergenic
987277223 5:16374693-16374715 CTGTACTTGTGGAAGAACCTGGG + Intergenic
992035403 5:72769789-72769811 CTCTGCTTCTGGAGGTGGCTTGG - Intergenic
993199240 5:84791174-84791196 CTGGGCTCATGGTGGTGCCTTGG - Intergenic
994955216 5:106521828-106521850 CAGTGCTTCTGAAAGAGCCTTGG - Intergenic
996463961 5:123778732-123778754 CTGTCCCCATGGCAGTGCCTAGG + Intergenic
998193787 5:140048665-140048687 CTGTGCGTGAGGAAGTGCTTTGG - Intergenic
998471918 5:142390238-142390260 CTTTGCATATGGAAGTGCACAGG - Intergenic
1001880450 5:175239344-175239366 CTGTGGTTAGGGAAGTGCCTGGG - Intergenic
1002599256 5:180344966-180344988 CTGTGCTTCTGGGTATGCCTTGG - Intronic
1002758353 6:182402-182424 ATGTGCTTATTGAAGAGCCTTGG - Intergenic
1003355645 6:5367183-5367205 CTGTGCTTTTGATAGTGACTTGG + Intronic
1005485289 6:26293769-26293791 CTGTGCTTCTGGGTGTTCCTGGG + Intergenic
1012188367 6:96249921-96249943 ATGTGGTTATGGAAATGCCCTGG - Intergenic
1012206135 6:96462655-96462677 CTGTACTTATTGAACTGCCCTGG - Intergenic
1013692556 6:112663135-112663157 CTGTGCTCAGGAAAGTGCCAGGG + Intergenic
1013709486 6:112880215-112880237 CTGTGCTCTTGGAAGGGGCTGGG - Intergenic
1013773674 6:113654594-113654616 CTGTGCTGCTGGCAGTGCCCTGG - Intergenic
1013798559 6:113912460-113912482 CTGTGCTTCTGGGAGTGCCTGGG - Intergenic
1014685703 6:124497375-124497397 CTGTGCTGCAGAAAGTGCCTAGG - Intronic
1014884589 6:126764344-126764366 CTGTGCTTATGCAAGTAGCGGGG + Intergenic
1016533949 6:145090392-145090414 CTGACCCTATGGCAGTGCCTAGG + Intergenic
1017526229 6:155243428-155243450 CTCTGCTTAGGTAAGTGTCTTGG - Intronic
1017585326 6:155914835-155914857 CTGTGCTTATGGAAGGTGCTAGG + Intergenic
1020480639 7:8655910-8655932 CTGTGCTTACGGTTGTGCCAAGG - Intronic
1021286251 7:18784547-18784569 CTGTGCTTCTGCAAATGTCTGGG - Intronic
1021658198 7:22892684-22892706 AGGTGCTTAGGGGAGTGCCTGGG + Intergenic
1023851595 7:44153211-44153233 CTGTGAGTCTGGGAGTGCCTGGG + Intronic
1024520366 7:50300535-50300557 CTGTCCTGCTGGCAGTGCCTGGG - Intergenic
1025082463 7:55995596-55995618 CTGTGCTTATTCACATGCCTGGG - Intronic
1028086020 7:86638877-86638899 CTGTGCTTATGGAAATGATGAGG - Intergenic
1030252586 7:107463839-107463861 CTGTGCTCCTGGAAGTGCTTGGG + Intronic
1031519305 7:122743972-122743994 CTGTGCTTATGGAAGAGGACAGG - Intronic
1032991052 7:137395484-137395506 CTGTGCTTATGGAAGTGCCTGGG - Intronic
1033448092 7:141439329-141439351 CTGTGGTTATGGCAGAGGCTGGG + Intronic
1034441796 7:151089383-151089405 CTGTGTTTATGTAACAGCCTAGG - Intronic
1034826996 7:154274914-154274936 CTGTGATTATGACAGAGCCTGGG - Intronic
1036031606 8:4980222-4980244 CTGTGCTTATCCAGCTGCCTGGG + Intronic
1037380445 8:18279710-18279732 CTTTGCTTATTCAACTGCCTTGG + Intergenic
1040731934 8:50457838-50457860 CTGTACTTATGGCAGTGCCTGGG - Intronic
1041547669 8:59064056-59064078 CTGGGATTATTGAAGTGCTTGGG + Intronic
1044011999 8:87005826-87005848 TGGTGCTTATGGAAGAGCCTGGG + Intronic
1044931913 8:97259516-97259538 GTGTGGTTTTGGCAGTGCCTGGG - Intergenic
1048354067 8:133639240-133639262 CTCTGCTTAGGGAAGTTCGTTGG - Intergenic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048600370 8:135913542-135913564 GTGTGGTTGTGGAAGTTCCTAGG - Intergenic
1049415447 8:142492865-142492887 CTGTGCTGGTGGAAGTGCTGGGG - Intronic
1056923547 9:90813314-90813336 CAGTGCTGATGGAGGTGGCTGGG - Intronic
1057735429 9:97654617-97654639 CTGTGCGTATGGAGGGGCATGGG + Intronic
1059396630 9:114038250-114038272 CTGTGATTAGGGAAGAGCCTGGG + Intronic
1060690556 9:125654551-125654573 CTGTACTTAGGCATGTGCCTTGG - Intronic
1060927893 9:127468013-127468035 CTGTGGTTATGGGAGTGCAGTGG + Intronic
1061399994 9:130363055-130363077 CTCTCCTTTTGGAAGTGACTGGG - Intronic
1185603799 X:1355572-1355594 CTGAGGATGTGGAAGTGCCTGGG + Intronic
1190112978 X:47606965-47606987 CTGTGGATATGGAAGTTCTTCGG - Exonic
1191077796 X:56474087-56474109 CTTTCCTTATTGAAGTGGCTTGG + Intergenic
1191878843 X:65824062-65824084 CAGAGCTTTTGGTAGTGCCTTGG + Intergenic
1192782672 X:74309824-74309846 CTGTGCCTATTGAAGTTTCTGGG - Intergenic