ID: 1032991159

View in Genome Browser
Species Human (GRCh38)
Location 7:137396233-137396255
Sequence CTGTGTGAGTGGCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032991150_1032991159 29 Left 1032991150 7:137396181-137396203 CCAAGTTCAAAGAACCAGGCCAA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data
1032991153_1032991159 4 Left 1032991153 7:137396206-137396228 CCCACTCTGCTCTATCCACTTTA 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data
1032991152_1032991159 10 Left 1032991152 7:137396200-137396222 CCAACACCCACTCTGCTCTATCC 0: 1
1: 0
2: 2
3: 30
4: 353
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data
1032991154_1032991159 3 Left 1032991154 7:137396207-137396229 CCACTCTGCTCTATCCACTTTAG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data
1032991149_1032991159 30 Left 1032991149 7:137396180-137396202 CCCAAGTTCAAAGAACCAGGCCA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data
1032991151_1032991159 15 Left 1032991151 7:137396195-137396217 CCAGGCCAACACCCACTCTGCTC 0: 1
1: 0
2: 4
3: 26
4: 329
Right 1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032991159 Original CRISPR CTGTGTGAGTGGCAGGTGGA AGG Intronic
No off target data available for this crispr