ID: 1032994775

View in Genome Browser
Species Human (GRCh38)
Location 7:137432815-137432837
Sequence CAGGGAAATATTGGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 412}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032994775_1032994782 -9 Left 1032994775 7:137432815-137432837 CCTTCCTTCCCAATATTTCCCTG 0: 1
1: 1
2: 4
3: 56
4: 412
Right 1032994782 7:137432829-137432851 ATTTCCCTGGTAAGGCCAAAGGG 0: 1
1: 0
2: 2
3: 12
4: 120
1032994775_1032994781 -10 Left 1032994775 7:137432815-137432837 CCTTCCTTCCCAATATTTCCCTG 0: 1
1: 1
2: 4
3: 56
4: 412
Right 1032994781 7:137432828-137432850 TATTTCCCTGGTAAGGCCAAAGG No data
1032994775_1032994787 30 Left 1032994775 7:137432815-137432837 CCTTCCTTCCCAATATTTCCCTG 0: 1
1: 1
2: 4
3: 56
4: 412
Right 1032994787 7:137432868-137432890 CTCCATATCCCATACTCTTGTGG No data
1032994775_1032994786 6 Left 1032994775 7:137432815-137432837 CCTTCCTTCCCAATATTTCCCTG 0: 1
1: 1
2: 4
3: 56
4: 412
Right 1032994786 7:137432844-137432866 CCAAAGGGATGTAGTTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032994775 Original CRISPR CAGGGAAATATTGGGAAGGA AGG (reversed) Intronic
902230070 1:15022191-15022213 CAGGGAAGTGATGGGAGGGAGGG - Intronic
902692077 1:18116288-18116310 CAGGGAGGGATTAGGAAGGATGG - Intronic
902864664 1:19270213-19270235 CAGGGGAAGGTAGGGAAGGAAGG + Intergenic
902866887 1:19285649-19285671 CAGGGGAAGGTAGGGAAGGAAGG + Intronic
903733766 1:25517032-25517054 CAGGGAAAGATTGGGATTCAGGG - Intergenic
904307314 1:29598656-29598678 CAGGTAAACATTGGTCAGGAAGG + Intergenic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
906041032 1:42787944-42787966 CAGGGAAATCTGGGAAGGGAAGG - Intronic
906131917 1:43465302-43465324 CAGGGTAAGACTGGGAAGGTGGG - Intergenic
906816993 1:48889384-48889406 TAGGGAAATGTTGGAAGGGAGGG + Intronic
908625101 1:66031351-66031373 CAGGGAAACATGGTCAAGGAAGG + Intronic
908650316 1:66325792-66325814 CAGAGAAGTGGTGGGAAGGAGGG + Intronic
909961356 1:81847687-81847709 GAGGGAAATATTAGGGAGAAAGG - Intronic
910486293 1:87718113-87718135 CAAGAAAATACTGGCAAGGAAGG + Intergenic
910768274 1:90804543-90804565 CAGTGCAATGTTGGGAAGCAGGG + Intergenic
911068389 1:93812489-93812511 CAGGGAAATGGTGGGCAGAAAGG - Intronic
911403436 1:97406162-97406184 CAGGCAAATATAGGGAACTATGG - Intronic
912060602 1:105663766-105663788 CAAGGAAATATGGGGAAGAGGGG + Intergenic
912393368 1:109320378-109320400 CACTGAGATAGTGGGAAGGAAGG - Intronic
913583486 1:120250096-120250118 CAGGGAAGTAATGGGAAGACTGG - Intergenic
913624689 1:120648223-120648245 CAGGGAAGTAATGGGAAGACTGG + Intergenic
914565473 1:148861933-148861955 CAGGGAAGTAATGGGAAGACTGG - Intronic
914607352 1:149268316-149268338 CAGGGAAGTAATGGGAAGACTGG + Intergenic
914929143 1:151914586-151914608 GTGGGAAACATTTGGAAGGAGGG + Intergenic
915750251 1:158200793-158200815 CAGGGGAACAATGGGAAGAATGG + Intergenic
916168157 1:161981520-161981542 CAGGGAAAGATGGGAAGGGAGGG - Intergenic
917099130 1:171428339-171428361 CTTGGAAGTACTGGGAAGGAGGG + Intergenic
918386505 1:184013555-184013577 GAGGGAAGAATGGGGAAGGACGG + Intronic
918393516 1:184090925-184090947 CAGGGACATATTGGAGAGGGAGG + Intergenic
919539759 1:198831671-198831693 AAGGGAAGTGCTGGGAAGGAAGG - Intergenic
919570769 1:199244065-199244087 TTGGGAAAGATTGTGAAGGAAGG - Intergenic
919773312 1:201176846-201176868 CCTGGAACTATGGGGAAGGAGGG - Intergenic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
921552069 1:216549333-216549355 GAGAAAAATATTGGAAAGGAGGG + Intronic
923110202 1:230884119-230884141 CAGGGAAATAGTTGGAAGGGAGG + Intergenic
923569489 1:235101262-235101284 CTAAGAAATATTGAGAAGGAGGG + Intergenic
924020637 1:239777958-239777980 CGGGGAAAGGTTGGGAGGGAAGG + Intronic
924262424 1:242245902-242245924 GAGGGAAATGCTGTGAAGGAAGG - Intronic
1063598443 10:7458650-7458672 CAGTGAAGGAGTGGGAAGGAAGG - Intergenic
1063894151 10:10661778-10661800 CAGGAACATATTAGGCAGGAAGG + Intergenic
1064962258 10:20978201-20978223 CAGGGAAGTGTTGGGGAAGATGG - Intronic
1065886286 10:30080413-30080435 CAGGAATATATTGGAAAGGATGG - Intronic
1066346315 10:34590386-34590408 AAGGGAAAAGTTGGGAAGTAGGG - Intronic
1068494419 10:57768240-57768262 CAGTATAATATTGGAAAGGAAGG - Intergenic
1068809007 10:61234773-61234795 AAGAGAAATAGTGGGGAGGAAGG - Intergenic
1068936993 10:62645721-62645743 CAGGGAAGTGATGGGATGGATGG + Intronic
1069026744 10:63550630-63550652 CAGGGTAGTATTGTTAAGGATGG + Intronic
1069146864 10:64903427-64903449 TAGTGAAAAATTGGGAAGGAAGG + Intergenic
1069887938 10:71635627-71635649 CAGGGCAAGAGGGGGAAGGAGGG + Intronic
1070519138 10:77236525-77236547 CAGGGAACTTTAAGGAAGGATGG - Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1071687998 10:87782547-87782569 CTGTGAATTATTTGGAAGGAAGG + Intronic
1072220763 10:93325826-93325848 CTGGGAAATGTTGGGCTGGAAGG + Exonic
1073299057 10:102459718-102459740 AAGAGAGAGATTGGGAAGGAGGG + Intergenic
1073713122 10:106068564-106068586 TTGGTAAATATTGGGAAGAAGGG + Intergenic
1073944029 10:108730144-108730166 GAGGGAGATAGAGGGAAGGAGGG + Intergenic
1074399797 10:113132769-113132791 TAGAGAAATATTTGGCAGGAGGG + Intronic
1074500738 10:114021785-114021807 CAGGGTACTATTTGGAAGGAGGG - Intergenic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074982011 10:118627265-118627287 CAGGGAAAACTTGGAAAGGCAGG + Intergenic
1074989317 10:118688798-118688820 CATGGAAATATAGGGTAGGCTGG - Intronic
1075188868 10:120287697-120287719 CAGTGGGCTATTGGGAAGGAGGG + Intergenic
1075389916 10:122084609-122084631 CAGGGAAGGATTGGGAAGAATGG + Exonic
1075620212 10:123921958-123921980 CAGGGAAACATGGGGAGGGATGG - Intronic
1077150053 11:1068844-1068866 CAGGGATTTGTGGGGAAGGATGG + Intergenic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1079801255 11:24872131-24872153 TAGAGAGATATTGAGAAGGATGG - Intronic
1079817022 11:25074114-25074136 CAGAGAACTGTTGTGAAGGAAGG - Intronic
1079817213 11:25076632-25076654 AAGGGAAAAAGAGGGAAGGAAGG + Intronic
1080047842 11:27827831-27827853 ATAGGAAATATTGGGATGGAGGG + Intergenic
1080068709 11:28052356-28052378 CAGAGAGATAAAGGGAAGGAAGG - Intronic
1080242641 11:30144251-30144273 CAGGGAAATGTAGGTAAAGAAGG - Intergenic
1080544463 11:33302195-33302217 TTAGGAAAAATTGGGAAGGAAGG - Intronic
1081174701 11:39912982-39913004 GAGTAGAATATTGGGAAGGAGGG - Intergenic
1082105638 11:48218251-48218273 CAGGGAATATTTAGGAAGGAGGG + Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1082751483 11:57022849-57022871 CAGGAAAATACTGGGTAGAAGGG - Intergenic
1083489231 11:63002980-63003002 CAGGGAAAGAATGGCTAGGAAGG - Intronic
1088030220 11:105239679-105239701 CAAGAAGATATTGGGAAAGAAGG + Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1090542153 11:127719116-127719138 CAGGCAAAAAGTGGGAAGGAAGG + Intergenic
1090785330 11:130043174-130043196 ATGGGAAATATTTGGAAAGAGGG + Intergenic
1091836300 12:3588499-3588521 CAGGCAAATAGTGAGAAGTAGGG - Intronic
1092920546 12:13227843-13227865 CACTGAAATATTGGGAAGAGAGG + Intergenic
1094053714 12:26247246-26247268 TAGGGCAATATTGGGAAGGATGG + Intronic
1094055671 12:26267286-26267308 CAGGAAAAAATTGGGAAAAATGG - Intronic
1094553774 12:31477331-31477353 CAGGGAAATAAAAGGAAGAAAGG + Intronic
1096800677 12:54108400-54108422 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1097357327 12:58616260-58616282 CAGGGGAGTAATGGGAAGAAAGG + Intronic
1097474344 12:60034850-60034872 CAGGAAAATGTGGGGAAGTATGG - Intergenic
1098373031 12:69780336-69780358 CAGGAAATTACTGGGAAGCATGG - Intronic
1098750222 12:74283539-74283561 CATGGAAATATGGGGAGGCAGGG - Intergenic
1098848382 12:75565832-75565854 CATGTATGTATTGGGAAGGATGG + Intergenic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1099855380 12:88158309-88158331 CATGGAAAAATTGGGAAAGGTGG - Intronic
1100199510 12:92283276-92283298 AAGGGAAATATAGGTAGGGAAGG + Intergenic
1102684541 12:114714419-114714441 CAGAGAAATCATGGCAAGGATGG - Intergenic
1102758658 12:115366310-115366332 CAGGAAAATATGGGAAAGTATGG + Intergenic
1103431610 12:120892572-120892594 AAAGGAAATATAGGGAAGCAGGG + Intronic
1104214215 12:126720213-126720235 CAGGGATATATTTAGAATGAGGG - Intergenic
1104256598 12:127144839-127144861 CAGTGAAATATGTGCAAGGATGG + Intergenic
1104542983 12:129684650-129684672 CAGGAAAATGTTGGGAAGTTTGG + Intronic
1104783827 12:131437397-131437419 CAGGGAAAGATGGGGAAGAGGGG + Intergenic
1106800808 13:33254484-33254506 CAGGGAAATATTGGATACCAGGG + Intronic
1107115919 13:36745427-36745449 GAGGGAAATATTGGTAAGGATGG + Intergenic
1107166893 13:37292869-37292891 CAGGGAAATTTTGAGAAAAAAGG + Intergenic
1107315683 13:39129202-39129224 AAGTGAAATCTTGTGAAGGAAGG + Intergenic
1107654322 13:42575311-42575333 CAGAGAGATAGTAGGAAGGAAGG + Intronic
1108190094 13:47929474-47929496 CAGGGAAATGAAGGGAAGCAGGG + Intergenic
1110184829 13:72660582-72660604 CATTGAAGTTTTGGGAAGGAAGG - Intergenic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1112512347 13:100020870-100020892 CGGGGGACTGTTGGGAAGGAAGG + Intergenic
1113412132 13:110099828-110099850 GAGGGAAATGTTGGAAATGATGG + Intergenic
1114357201 14:21924247-21924269 TATGGAAACTTTGGGAAGGAGGG + Intergenic
1114893897 14:26961487-26961509 GGGGGAAAAGTTGGGAAGGAAGG - Intergenic
1115311416 14:31982245-31982267 CAGGAAAATATGGGAAAGTATGG + Intergenic
1115431257 14:33321340-33321362 CTGGGAAACAATGGGAAGTAGGG + Intronic
1115747324 14:36450851-36450873 AAGAGAACTTTTGGGAAGGATGG - Intergenic
1115946217 14:38664192-38664214 CAGTGAAATAGAAGGAAGGAGGG + Intergenic
1116466780 14:45242609-45242631 CAGAGAAAGACTGGGCAGGAGGG - Intronic
1117960543 14:61157411-61157433 CCTGGAGATACTGGGAAGGAAGG + Intergenic
1122488110 14:102095159-102095181 AAGGGATGTATTGAGAAGGAAGG + Intronic
1123160138 14:106270179-106270201 GAGGGAAATAATGGGGAGGCAGG - Intergenic
1124044083 15:26131876-26131898 GAGTGAAATACAGGGAAGGAAGG - Intergenic
1124624276 15:31299176-31299198 CAGGGGAATGCAGGGAAGGAGGG + Intergenic
1124655928 15:31507288-31507310 CAGGGTTATATTGAGAAGGTTGG + Intronic
1124936860 15:34180932-34180954 CTGTGAAATATTTTGAAGGAAGG - Intronic
1125160877 15:36642106-36642128 GAGGGAAATACTGGGCAGGTGGG - Intronic
1125718785 15:41835256-41835278 CAGGGAAGATATGGGAAGGAGGG + Intronic
1126901454 15:53318843-53318865 CAGGGAGCTATGGGGAAGGGGGG + Intergenic
1127286303 15:57536700-57536722 TAGGGAATCATTGGTAAGGATGG - Intronic
1127733473 15:61820715-61820737 GAGGGAAATGTTGAAAAGGATGG - Intergenic
1127747004 15:61988225-61988247 AAGGGAACTTTTTGGAAGGATGG + Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1130103529 15:80912119-80912141 CTGGGAAAGACTGGGAAAGATGG + Intronic
1130578581 15:85115226-85115248 CAGGCTAATGCTGGGAAGGATGG - Intronic
1130769162 15:86907051-86907073 CCGGGAAATATGGAGAAGAAAGG - Intronic
1131386849 15:92015048-92015070 CAGAGAAATACTGGGAAGCAGGG + Intronic
1132071005 15:98776580-98776602 CAGGGAGGTAGGGGGAAGGAGGG - Intronic
1132352722 15:101149827-101149849 TAAGGAAATAATGGAAAGGAAGG + Intergenic
1132405474 15:101539668-101539690 CATGGAAGTGTTGAGAAGGACGG + Intergenic
1132598294 16:763010-763032 CAGGGAAAGATGTGGAAGGCCGG + Intronic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1133687713 16:8181964-8181986 CAAGGACATTATGGGAAGGAAGG + Intergenic
1134153364 16:11822540-11822562 AAGGGAAAAAGTGGGCAGGAGGG - Intergenic
1134154586 16:11832454-11832476 GATGGAAATAATGGGAAGGCTGG - Intergenic
1134569482 16:15279234-15279256 CAGTGAAATAGTGGAAAGGAGGG + Intergenic
1134732895 16:16476815-16476837 CAGTGAAATAGTGGAAAGGAGGG - Intergenic
1134821909 16:17253780-17253802 CAGGGCATTATTGGGAAGCCAGG - Intronic
1134934544 16:18235156-18235178 CAGTGAAATAGTGGAAAGGAGGG + Intergenic
1135353338 16:21749026-21749048 CATGGGAATAGTGGGAAGAAGGG + Intronic
1135451825 16:22565149-22565171 CATGGGAATAGTGGGAAGAAGGG + Intergenic
1136232327 16:28894043-28894065 GAGGGAAATGGTGGGAAGGTAGG + Intronic
1136380794 16:29894424-29894446 CAGGGAAAGGGTGGGAGGGAGGG - Intronic
1137533644 16:49300409-49300431 CAGGGGACCATAGGGAAGGAAGG - Intergenic
1137954205 16:52812550-52812572 GAGGGACATCTTGGCAAGGAAGG + Intergenic
1138024650 16:53512921-53512943 TGGGGAACTATTGGGAAGGCAGG - Intergenic
1138404451 16:56778409-56778431 CAGGTAAATATTGAGCAGAAAGG + Intronic
1138534208 16:57651360-57651382 CAGGGAAGGATCGGGAAGCAGGG - Exonic
1138714597 16:59006675-59006697 CAGAGAGATATTGGCAAGAATGG - Intergenic
1138910344 16:61389419-61389441 CAGGAAAATTTAAGGAAGGAGGG + Intergenic
1139137137 16:64218138-64218160 CTGGGAAATCTTGGCAAGGAGGG + Intergenic
1139348837 16:66322704-66322726 CAGGGAATGATGGGGAAGGGAGG + Intergenic
1141059445 16:80852480-80852502 CAGGGAAAGTTCAGGAAGGAGGG - Intergenic
1142439946 16:90091152-90091174 CTGGGGAATATTGAGAAGAATGG + Intronic
1144466472 17:15501611-15501633 CAGTTAAAGATTGGGAAGGTGGG - Intronic
1144811022 17:17999027-17999049 CAGATAAATATCAGGAAGGAAGG - Intronic
1145060602 17:19730970-19730992 CAGAGAAATTTTGGGAAAGAAGG + Intergenic
1145240262 17:21236832-21236854 CAGGGGAGAACTGGGAAGGAAGG + Intergenic
1145936317 17:28716989-28717011 CAGGCACTTAGTGGGAAGGATGG + Exonic
1146546838 17:33747521-33747543 CAGGTAAAGTGTGGGAAGGATGG - Intronic
1147001794 17:37368622-37368644 CCTGGAAATATTGGGGCGGATGG - Intronic
1147424160 17:40337857-40337879 CAGGGAAAGAGTGGGAAGCAGGG - Intronic
1147604434 17:41766264-41766286 AAAGGAAAGAATGGGAAGGAAGG + Intronic
1148238947 17:45987488-45987510 AAGTGAAATACTGAGAAGGATGG - Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1149219142 17:54395193-54395215 CAGGAAAATATTAGGAATAAAGG - Intergenic
1149469769 17:56906793-56906815 CAGTGAAAGATTGGCAAAGAAGG - Intronic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1151767768 17:76140936-76140958 TAGGGGATCATTGGGAAGGAAGG + Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152556269 17:81054731-81054753 CAGGGAGACAGTGGGAAGAATGG - Intronic
1152957611 18:52402-52424 CTGGGGAATATTGAGAAGAATGG - Intronic
1153548512 18:6235664-6235686 CAGGGAAATAGGGGTATGGACGG + Intronic
1153925067 18:9828186-9828208 CTGGGGAATAGTGGGAAAGATGG + Intronic
1154390542 18:13932818-13932840 CAGGGAAACATTGGCAGGCAGGG + Intergenic
1155242901 18:23880227-23880249 CAGTGAGATTTGGGGAAGGAAGG + Intronic
1157127339 18:44969462-44969484 CAGGAAAGGCTTGGGAAGGAGGG - Intronic
1157628776 18:49075498-49075520 CAAGGAAATGTAGGGAAAGAAGG + Intronic
1158172186 18:54612634-54612656 GAGGGAAAGATTAGGAAGAAGGG - Intergenic
1158555159 18:58468965-58468987 CAGGGAAACATTGGTGAAGATGG + Intergenic
1158684960 18:59605172-59605194 CAGGGAGAAATGGAGAAGGAAGG + Intronic
1158776620 18:60589630-60589652 CAAGGAGATATTTTGAAGGAGGG + Intergenic
1159435898 18:68416495-68416517 TAGGGTGATTTTGGGAAGGAGGG - Intergenic
1159448478 18:68569352-68569374 AAGGGAAATATTAGTAGGGAGGG + Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1160446348 18:78929972-78929994 GAGGGAGACATGGGGAAGGAAGG + Intergenic
1162262534 19:9544539-9544561 CAGGGAAATATGGGGAAATGGGG - Intergenic
1163199036 19:15749320-15749342 CAGAGAAATATTGGGAGTGGAGG + Intergenic
1163339784 19:16698045-16698067 CAGAGGAATTTTGGGAGGGAAGG + Intergenic
1164210531 19:23093800-23093822 CAGGGGCATGGTGGGAAGGAAGG + Intronic
1164617064 19:29673619-29673641 CAGGGAACTACGGGGAGGGAAGG - Intronic
1165240399 19:34462205-34462227 CAGGGAGCTATTAGGGAGGAGGG + Intronic
1165330961 19:35141053-35141075 GAGGGGTAAATTGGGAAGGAGGG - Intronic
1165386753 19:35514397-35514419 CAGGGAACGAGTGGGAGGGAAGG + Intergenic
1165855599 19:38877993-38878015 CAGGGTGTTATTAGGAAGGAGGG + Intronic
1166315984 19:41990391-41990413 GAGAGATATATGGGGAAGGAGGG - Intronic
1166315995 19:41990463-41990485 GAGAGATATATGGGGAAGGAGGG - Intronic
1166316006 19:41990535-41990557 GAGAGATATATGGGGAAGGAGGG - Intronic
1166568592 19:43779846-43779868 CAGGGAAATAGTGGAGAGGTAGG - Intronic
1166685352 19:44793293-44793315 GAGGGAAATGCTGGGAGGGAAGG - Intronic
1167666043 19:50823293-50823315 CAGGGAACTAGGGGGCAGGAGGG + Intronic
925840882 2:7990610-7990632 CAGAGAAATATGGAGAGGGATGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927223184 2:20734547-20734569 CAGGGACATAATGGCAAGTAAGG - Intronic
927542254 2:23923530-23923552 CAGGGAAACTTTAGGAATGACGG + Intronic
927748663 2:25645912-25645934 GAGGGAAACAATGGGATGGAAGG + Intronic
928748632 2:34445357-34445379 CAGGAAATGCTTGGGAAGGAGGG - Intergenic
928823176 2:35387785-35387807 CAAGGAAAATTTGGGAAGGATGG + Intergenic
929321173 2:40545154-40545176 CATGGAAATAATGGCAAGAAAGG - Intronic
929685599 2:44031423-44031445 CAGAAAAACATTGGGATGGATGG + Intergenic
932148125 2:69342638-69342660 CAAGGAAATTTTGGGAGTGATGG + Intronic
932594692 2:73086723-73086745 TAGGGGAAGATTGGGAAGAAGGG - Intronic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
933649582 2:84839837-84839859 CAGTGAAATATTTGCCAGGAGGG - Intronic
934609875 2:95727160-95727182 CAGGCAAGTATTGGACAGGAAGG + Intergenic
935138754 2:100332788-100332810 CAGGGAAGTGTTGGGTAGGGTGG + Intergenic
935283752 2:101545137-101545159 AGGGGAAAGAGTGGGAAGGAGGG - Intergenic
935285460 2:101560372-101560394 CAGGGAAACACTGGGAATGGAGG - Intergenic
936709194 2:115111606-115111628 CAGGACAATATTGGGATGGTGGG + Intronic
936721105 2:115253895-115253917 AAGGGAAATATGGGGTTGGAGGG - Intronic
937654884 2:124363383-124363405 CAGGGAGATGTTAAGAAGGAGGG - Intronic
939093257 2:137803137-137803159 AAGGGAAAGATTGGAAAGGAGGG - Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939849474 2:147287150-147287172 CAGGAAATAATTGGGAAGAAAGG + Intergenic
940801992 2:158143609-158143631 AAAGGAAATATTGAGAGGGAAGG + Intergenic
941802340 2:169673761-169673783 GAGGGAAATTTTGGGAGTGATGG + Intronic
942044901 2:172094653-172094675 CAGGGCAGTTTTGGGAAGGTGGG + Intergenic
942576000 2:177364045-177364067 CAGGGCAACATTGGGAGGGAGGG - Intronic
942745930 2:179233116-179233138 CAGGGAAAATTTAGGAAGAAAGG + Intronic
943384552 2:187185064-187185086 CAGGGAAATTCTGGGCAGAAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944847361 2:203682115-203682137 CAGGGGAAGATGGGGAAGAAAGG + Intergenic
945852760 2:215029415-215029437 AAGGGCAATATTGGGAAGTGTGG - Intronic
946467881 2:219928426-219928448 CAGGGAACTCTTGGGAGAGAGGG - Intergenic
946482055 2:220066591-220066613 CAGGGAGAAATTGGGAGGGTGGG - Intergenic
946982772 2:225236086-225236108 CAGGGAAAGATTGAAAAAGAAGG - Intergenic
947015734 2:225617801-225617823 CAGGGAAACATTGGAGAGGTGGG + Intronic
947446501 2:230167667-230167689 CAGGGACAGATTCAGAAGGAGGG - Intronic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
948225579 2:236307000-236307022 GAGGGAAACATTAGGAGGGATGG + Intergenic
1169525337 20:6418220-6418242 CAGGTAGAAATTTGGAAGGATGG + Intergenic
1170878436 20:20272812-20272834 GAAGGAGATATGGGGAAGGAAGG - Intronic
1170968651 20:21099442-21099464 CATGGAAATATCTGCAAGGAAGG - Intergenic
1171795777 20:29565951-29565973 CAGGGAAAGATTGGGAAAGAGGG - Intergenic
1171852452 20:30318191-30318213 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1172100257 20:32480983-32481005 CTGGGAAATATGAGGCAGGAAGG + Intronic
1172319992 20:33988890-33988912 GAGGGAGGTATTGGGAGGGAAGG + Intergenic
1172589091 20:36105089-36105111 CAGGGGAATATTGGGATGTGGGG + Intronic
1173272544 20:41550854-41550876 TAGTGAAATATTTGGAAGAATGG - Intronic
1173343428 20:42175723-42175745 CAGTTAAATATTGGGAGGAAAGG + Intronic
1174162233 20:48559537-48559559 CTGGGAATTATGGGGAAGAAAGG + Intergenic
1174383024 20:50169640-50169662 CAGGGAGAGATTTGGAAGGAAGG + Intergenic
1175736004 20:61387827-61387849 CCGGGAAGGAGTGGGAAGGAAGG - Intronic
1177604571 21:23360913-23360935 CAGGAAAATGTGGGGAAGTATGG - Intergenic
1178097867 21:29234859-29234881 CAGGGAAATACTGGGTAGAAGGG - Intronic
1178796883 21:35752936-35752958 AGGGGAAAGATAGGGAAGGAGGG + Intronic
1180016703 21:45091193-45091215 TAGGGGAAAATTGGCAAGGACGG - Intronic
1180081983 21:45491222-45491244 CAGGGAGATCCAGGGAAGGACGG + Exonic
1180321543 22:11326012-11326034 CCTGGAAATATTGAGAAGAATGG - Intergenic
1180333512 22:11554746-11554768 CTGGGAAATATTGAGAAGAATGG + Intergenic
1181748930 22:24975782-24975804 CAAGGAAATATAGCCAAGGATGG + Intronic
1182094568 22:27617315-27617337 AAGGAAAGCATTGGGAAGGAAGG + Intergenic
1182248525 22:28980479-28980501 AAGGGATATTTTGGGAAGGAAGG - Intronic
1182356561 22:29724835-29724857 CAGGTGAATATTGGGATGCACGG - Intronic
1182680351 22:32074560-32074582 CTGGGAAATGCTGGGAAGGCTGG - Intronic
1182931604 22:34179707-34179729 CAGGGAAATATTGTGGAAAAGGG + Intergenic
1183174604 22:36213522-36213544 AGGGGAAAAATTGGGCAGGAGGG + Intergenic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
1184953660 22:47864703-47864725 CAGGGGATTATTGACAAGGAGGG - Intergenic
1185026859 22:48419260-48419282 CAGGGAGATAATTGGATGGAAGG + Intergenic
1185375327 22:50480391-50480413 CAGGGAACAGTGGGGAAGGAGGG - Intergenic
949318724 3:2785757-2785779 CAGGGATATACTGGGTAGAAGGG + Intronic
953872679 3:46641154-46641176 AAGGGAAACATTGATAAGGAAGG - Intergenic
954957528 3:54534970-54534992 CAGAGAAGAATTGGGAATGACGG - Intronic
955468292 3:59258925-59258947 CAGAGGAATAATGCGAAGGAGGG - Intergenic
955722684 3:61900372-61900394 CATTGAGAGATTGGGAAGGAGGG - Intronic
956413103 3:68998890-68998912 CAGGGAAGTACTGGCAATGATGG + Intronic
957230831 3:77511821-77511843 CAGGGAAATAGTAAGAAGCAAGG - Intronic
959000024 3:100953235-100953257 CCCGGAAATAGTGGGAAGGGTGG - Intronic
959348292 3:105227624-105227646 CAAGGAAATATTGAGATGTATGG - Intergenic
961486832 3:127222577-127222599 CAGGGAAGCAGTGGGAGGGAGGG + Intergenic
961939639 3:130623839-130623861 CAATGAATTATTAGGAAGGAAGG + Intronic
962490851 3:135892836-135892858 AAGGGAAATAAAAGGAAGGAAGG + Intergenic
963936595 3:151060302-151060324 CAGGGAAGAAATGGGAAAGAAGG + Intergenic
965075859 3:163974597-163974619 CAGAGAATTATTGGGAAGCAGGG + Intergenic
965233326 3:166082329-166082351 GAGGTGAATATTGGGAAGGTTGG + Intergenic
965882223 3:173399371-173399393 AAGGGAGACAATGGGAAGGACGG - Intronic
968222510 3:196948919-196948941 AAGGGAAGTAAAGGGAAGGAAGG - Intronic
968864002 4:3196057-3196079 CAGGGAAACCCTTGGAAGGAGGG + Intronic
968902210 4:3437060-3437082 CAGGGAAATGCTGGGCAAGAAGG + Intronic
973193185 4:47409707-47409729 CAGGAAAATACTGGAAAGAAGGG - Intronic
973635273 4:52856581-52856603 CCGGGAAATCTGGGGAGGGAGGG - Intergenic
973853697 4:54987738-54987760 CAGGGAAATATTGAAAACCAGGG + Intergenic
975032162 4:69634380-69634402 CAGGGAAAGGGTGGGAAGCAGGG + Intronic
975297275 4:72749296-72749318 CAGAGAAATTCTGGGAGGGAAGG + Intergenic
975367773 4:73548554-73548576 CAGAGACATTTTGGGAAGGAAGG - Intergenic
975621402 4:76300229-76300251 GAGGGAAATATGAGGGAGGAAGG - Intronic
976056542 4:81075577-81075599 TAGAGAAATATTGAGAAGGTAGG + Intergenic
976449340 4:85168773-85168795 CAGGGAAATAGGAGAAAGGAAGG + Intergenic
976506977 4:85859121-85859143 TAGGGAAAAAATGTGAAGGATGG + Intronic
976792015 4:88889034-88889056 CAGGGGAATAATGACAAGGAGGG + Intronic
976964600 4:91021098-91021120 CAAGGAAAAATTGGAAAGGTTGG + Intronic
977254625 4:94727320-94727342 CAGGGATATACTGGGTAGAAGGG + Intergenic
977672842 4:99716009-99716031 CAGGGAAATTTTGGGCAGAAGGG + Intergenic
978228253 4:106364973-106364995 TAGGGAAATATTGAGACGTATGG + Intergenic
978897167 4:113903018-113903040 AAGGAACATATTGGGAAGGAGGG - Exonic
979146077 4:117250707-117250729 CAGGAAAATATGGGGAAGTTTGG + Intergenic
980534027 4:134092095-134092117 CAGGGAAATACTGGGTAGAGGGG + Intergenic
980871403 4:138615434-138615456 CAGGGAAATACTGGGTAGAAGGG + Intergenic
980877538 4:138677041-138677063 CTGGGAAATTTTGGGAAGTGGGG - Intergenic
980884001 4:138742435-138742457 CAGGGAAATTTTAGGAAGAAAGG + Intergenic
981362718 4:143866221-143866243 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981373450 4:143987022-143987044 CAAGGAAATATTGGGGAGAAGGG + Intergenic
981382552 4:144090276-144090298 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981815915 4:148830201-148830223 CAGGGAAATACTGGGTAGAAGGG - Intergenic
982709151 4:158742850-158742872 CAGGGAAATATTAGTAGGGCAGG + Intergenic
983969476 4:173853566-173853588 AAGGGAAATAATAGCAAGGATGG + Intergenic
985036610 4:185846795-185846817 CAGGGAAAGTTTGGGAGAGAGGG + Intronic
986171240 5:5316627-5316649 CAGGGAGAGAGAGGGAAGGAAGG - Intronic
986902791 5:12457749-12457771 CAGTGAAATAATGAGAAGGCAGG - Intergenic
988521325 5:31947882-31947904 GAGGGAAAGAGAGGGAAGGAAGG + Intronic
988586052 5:32508526-32508548 CAGGAAAAATTTGTGAAGGAGGG + Intergenic
988598072 5:32613743-32613765 CAGGGAAATATTATCAAGGGTGG + Intergenic
989799153 5:45514362-45514384 CAGAGAAATATTGGAAGAGACGG - Intronic
990052007 5:51514071-51514093 CAGGAAAATATTTAGAAGTAAGG + Intergenic
990285347 5:54296189-54296211 CAGGGAGATTTTTGGAAGGCTGG + Intronic
991257899 5:64635482-64635504 CAGTGAAATAATGGGAGAGATGG - Intergenic
991646690 5:68808022-68808044 GAGGGAAGAAGTGGGAAGGAGGG + Intergenic
991942092 5:71863075-71863097 CAGGGAGAGATAGGGAAGCAAGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
992605102 5:78447935-78447957 CAGGGAAAGAGGGGGAAGGAGGG - Intronic
993168844 5:84389762-84389784 CAGTGAAATATTAGGAAGTAGGG - Intergenic
993928527 5:93904064-93904086 CAGAGAAGTATTTGAAAGGAAGG + Intronic
993963226 5:94327632-94327654 CAGGCAAATATTTGAAAAGAAGG - Intronic
994520790 5:100831991-100832013 CTAGGAAATATTTAGAAGGAAGG + Intronic
994548636 5:101204299-101204321 CAGGGAAATATGGGAAAGTTTGG + Intergenic
994608665 5:102007333-102007355 CAGATAAATATCGGGAAGGAAGG - Intergenic
995219329 5:109630373-109630395 CAGAGAATTGTGGGGAAGGAAGG + Intergenic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
997017048 5:129948330-129948352 CAGGAAAATAGGTGGAAGGAGGG - Intronic
997804930 5:136907446-136907468 AAGGGAAATATTTGGATGCAGGG + Intergenic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998435575 5:142105316-142105338 CAGGTAAGGATTGGGAAGAAAGG - Intergenic
999917148 5:156275141-156275163 CAGGGGATTATGGGCAAGGAAGG - Intronic
1000088530 5:157910057-157910079 CAGACAAATATATGGAAGGAGGG + Intergenic
1000314768 5:160079191-160079213 AAGTTAAATAATGGGAAGGACGG - Intronic
1000474863 5:161693889-161693911 TAGGGAATTCTTGGGAAGGGTGG - Intronic
1001150343 5:169221814-169221836 CAGAGACATAGTGGGAAGAAAGG - Intronic
1001419968 5:171578921-171578943 CAGGGAAAGATTTGGATGGTGGG + Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1003194887 6:3905932-3905954 CCTGGAAATATAGGGAAGGAGGG + Intergenic
1003381443 6:5628257-5628279 CAGGGAAAATTTCTGAAGGAAGG + Intronic
1003682274 6:8267869-8267891 CAGGGGAATATTGAGAGTGATGG - Intergenic
1004188247 6:13440834-13440856 CAGGGAAATTTTGGCAAAGCTGG - Intronic
1004279736 6:14270477-14270499 CAGTGATGCATTGGGAAGGAAGG + Intergenic
1004331860 6:14728979-14729001 AAGGAAAAAAATGGGAAGGAGGG + Intergenic
1004698212 6:18053994-18054016 CAGTGACATGTTGGGAAGGAAGG + Intergenic
1005392686 6:25349684-25349706 CAGGGCAGTATTGGGAGGGTGGG - Intronic
1005881760 6:30067515-30067537 CTGGGAGATACTGGGAGGGAGGG + Intronic
1006107674 6:31726431-31726453 CAGGCAGATAGTGTGAAGGAGGG - Intronic
1006259752 6:32857980-32858002 GAGGGAAATATTAGGAATAAAGG - Intronic
1007684286 6:43656028-43656050 AAGGGAAAGAAGGGGAAGGAAGG - Intronic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008701996 6:54111885-54111907 TAGGGAAATATAAGAAAGGAAGG + Intronic
1008834774 6:55812287-55812309 TAGGGATAAATTGGGAAGGTGGG + Intronic
1009296728 6:61960060-61960082 CAGGGAAATATTTGGCGAGAAGG - Intronic
1009415579 6:63412624-63412646 AAGGGAAAGAAAGGGAAGGAAGG + Intergenic
1010328773 6:74596555-74596577 AAGGGAAAAATTGGGAAACATGG + Intergenic
1013578818 6:111511613-111511635 TAGGAAAATATTGGGAAAAATGG + Intergenic
1016021548 6:139241372-139241394 AAAGGAGAAATTGGGAAGGAAGG + Exonic
1016384414 6:143516585-143516607 CCGGAAGACATTGGGAAGGACGG - Intergenic
1017921630 6:158877988-158878010 AAGGGAAATAATGAGAAAGATGG - Intronic
1019501548 7:1367247-1367269 CAGGGGATTCCTGGGAAGGAGGG - Intergenic
1019825308 7:3279523-3279545 GAGGGAAAGATGGGGGAGGAGGG + Intergenic
1020985774 7:15132579-15132601 CAGGGAAATAATGGCCTGGAAGG + Intergenic
1021325634 7:19263836-19263858 CAGGGAGATATAGGGAAACAGGG + Intergenic
1027991693 7:85371189-85371211 CAGTGTACTAATGGGAAGGAAGG - Intergenic
1028301579 7:89207072-89207094 CAGGAAAATATGGGAAAGTATGG - Intronic
1028406910 7:90485262-90485284 TAGGAAAATATGGGGATGGATGG - Intronic
1028420131 7:90623461-90623483 CATGGCAATAGTGGGAAAGAAGG + Intronic
1028604842 7:92644496-92644518 AAAGGAAATATTGTGATGGAGGG - Intronic
1029831919 7:103269318-103269340 CAGGGAAAGTTCGGGATGGAGGG + Intergenic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1032439744 7:131933312-131933334 CAGGGAAGGAATAGGAAGGAAGG + Intergenic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033122276 7:138676750-138676772 AATGGAAGTATTGGGAAGAATGG - Intronic
1033785216 7:144721962-144721984 CAGGAAAAAAAGGGGAAGGAGGG - Intronic
1035960826 8:4135402-4135424 GAGGGAAAGAGGGGGAAGGAAGG + Intronic
1036010717 8:4719388-4719410 CAGAGAATTATAGGGCAGGAAGG - Intronic
1036245041 8:7108826-7108848 CAGGGAAATCTAAGGAAGGGTGG + Intergenic
1036699109 8:10999929-10999951 AAGAGAAATATGGGCAAGGAAGG + Intronic
1037624172 8:20593115-20593137 CAGGGAAACATTGGGTAAAAGGG - Intergenic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1037647820 8:20809859-20809881 GAGGGAGATAATGGGGAGGAAGG - Intergenic
1038524957 8:28264658-28264680 CAGGCAAAGATTGGGAAAGATGG + Intergenic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1038667502 8:29552591-29552613 AGGGGTAATATTGGAAAGGAGGG - Intergenic
1038857436 8:31348873-31348895 CAGGGATAAATTGGGAAGAGGGG - Intergenic
1039091603 8:33835579-33835601 CAAGGAAATGTTGTGAAGGGTGG + Intergenic
1039119335 8:34128444-34128466 CAGGGAGGTATGGGAAAGGAAGG + Intergenic
1039900472 8:41748604-41748626 CAGAGAAAGGTTGTGAAGGAAGG - Intronic
1039911007 8:41826883-41826905 CAGGGAAAGATTTAGATGGATGG - Intronic
1040852417 8:51914615-51914637 CAGGGAAGGAAAGGGAAGGAAGG - Intergenic
1040898205 8:52390233-52390255 CAGGGAGATAACGGGAAGGGAGG - Intronic
1041311886 8:56525477-56525499 ATGGGAAAGATTGGGTAGGAGGG + Intergenic
1041366053 8:57105914-57105936 CAGGGATATAATGTGAAGAATGG - Intergenic
1043084860 8:75816700-75816722 AAGGAAAATATTGAGAAGTATGG - Intergenic
1045346056 8:101294724-101294746 CAGGGAGAAAGTGGGCAGGAAGG - Intergenic
1045478484 8:102574122-102574144 CAGGGACATCTTGGGAAAGAGGG - Intergenic
1045850774 8:106696118-106696140 CAGGGAAAGAAAGGGAAGGAGGG - Intronic
1046611922 8:116435353-116435375 CAGAGAAAGATTGGGAAGACTGG + Intergenic
1046860955 8:119091181-119091203 CAGGGCAATATTGGCAAGACTGG + Exonic
1048332482 8:133480097-133480119 CAGGGAAGGATGGGGAAGGAGGG + Intronic
1048859947 8:138716850-138716872 CAGGGAGAAATTGGGGAGCAGGG - Exonic
1050046283 9:1549594-1549616 AAGGGAGAGAGTGGGAAGGAGGG + Intergenic
1050086650 9:1972907-1972929 TGGGGAACTATTGGGAAGGCAGG + Intergenic
1050347600 9:4707853-4707875 CAGGCAAATCCTGGGAAAGAAGG - Exonic
1051845818 9:21450010-21450032 CTGCAGAATATTGGGAAGGATGG + Intergenic
1053729223 9:41035556-41035578 CAGAGATTTATTGAGAAGGAGGG + Intergenic
1053790244 9:41681489-41681511 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1054154898 9:61633266-61633288 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054178590 9:61893190-61893212 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1054474686 9:65564391-65564413 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054658943 9:67687639-67687661 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054699290 9:68396510-68396532 CAGAGATTTATTGAGAAGGAGGG - Intronic
1054735636 9:68747066-68747088 CAGGGAAAGAATGAGAGGGAAGG - Intronic
1055749239 9:79486502-79486524 CAGGGCTGTATTGGAAAGGAAGG - Intergenic
1055957902 9:81791589-81791611 AAGGGAAAGAAAGGGAAGGAAGG - Intergenic
1056633408 9:88312335-88312357 CAGGTAAATAACAGGAAGGAAGG - Intergenic
1056765581 9:89442793-89442815 CTGGGAAATGGTGAGAAGGATGG - Intronic
1056781587 9:89554972-89554994 CAGGGAAATGTGGGGACAGATGG - Intergenic
1059344753 9:113620616-113620638 CAGGGAAACAGCGGGAAGGAAGG - Intergenic
1059562527 9:115348851-115348873 CAGGGAAATATGGGAAAGGTTGG - Intronic
1059951438 9:119466470-119466492 CAGGGAGATATTGTGAAGATGGG + Intergenic
1060190665 9:121590280-121590302 CAGGGGAGGAGTGGGAAGGAGGG - Intronic
1061415995 9:130447115-130447137 CAGAGAAATAGTGGGCAGGTTGG + Intronic
1061963149 9:133998398-133998420 GAGGGATAGATGGGGAAGGATGG - Intergenic
1062201201 9:135303731-135303753 CAGGGAAATATTGGGAGGACTGG - Intergenic
1062740533 9:138172168-138172190 CTGGGGAATATTGAGAAGAATGG + Intergenic
1186602095 X:11049301-11049323 CAGGGAGAGATTGGGAAGAGTGG - Intergenic
1186733329 X:12433846-12433868 CAGGGAAATATTTGTAAGCAGGG + Intronic
1188342895 X:29027196-29027218 CCAGGAATTAGTGGGAAGGAAGG - Intronic
1189304574 X:39977209-39977231 CAAGGAAACTTTGGGAATGATGG + Intergenic
1189373932 X:40451638-40451660 CAGGGGAACATTAGAAAGGAAGG - Intergenic
1189498641 X:41532579-41532601 GAGGGAAAAAAAGGGAAGGAAGG - Intronic
1190707052 X:53038059-53038081 CAAGTAAATATTGTGAATGACGG + Intergenic
1191669081 X:63732350-63732372 ATGGGAAAAATTGAGAAGGAGGG - Intronic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1195657586 X:107347015-107347037 CAGGGAAAGATTTGGGAGGGAGG + Intergenic
1195938892 X:110150572-110150594 CAGGGAACTATATGGATGGAGGG - Intronic
1196817251 X:119675215-119675237 CAGGGCAGAATTGGGAGGGAGGG - Intronic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic
1198086834 X:133290079-133290101 CAGAGAAATACTGGGAAGAAAGG - Intergenic
1198325285 X:135565182-135565204 CAGGGAATAATTTGGAAGGCAGG - Intronic
1200538215 Y:4425381-4425403 CAAGGAAATGTGGGGAAGGGAGG - Intergenic
1201068541 Y:10123239-10123261 CTGGGGAATATTGAGAAGAATGG + Intergenic
1202340628 Y:23861231-23861253 CAGGGAATTTGTTGGAAGGATGG - Intergenic
1202530138 Y:25808851-25808873 CAGGGAATTTGTTGGAAGGATGG + Intergenic