ID: 1032998878

View in Genome Browser
Species Human (GRCh38)
Location 7:137480914-137480936
Sequence AGGCATTTATAGATGTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032998878 Original CRISPR AGGCATTTATAGATGTAGTA GGG (reversed) Intronic
915649103 1:157294659-157294681 AGGAATTTAGAGAGGTAGTCTGG - Intergenic
915870429 1:159554320-159554342 AGGTATTTATATATGTAACAGGG - Intergenic
917829731 1:178867965-178867987 AGGCAAATATAGATGGAGTATGG + Intronic
918897085 1:190361934-190361956 AGGCCTTTATAGAAGTAATTAGG + Intronic
922997008 1:229972139-229972161 ATGCATGTATATATGTAGTGTGG - Intergenic
1064555592 10:16544165-16544187 AGGCTTTTATTTATGTGGTAAGG - Intergenic
1066596514 10:37056715-37056737 AGGTACTTAAAAATGTAGTATGG + Intergenic
1067164975 10:43858210-43858232 AGGCACTTATATTTGCAGTAAGG + Intergenic
1071042616 10:81332589-81332611 ATGAATTTATACATATAGTATGG + Intergenic
1071143536 10:82540899-82540921 AGGCCTTTAAAGATGTTTTAAGG + Intronic
1073672959 10:105612973-105612995 GGGCATTTAAAGATGTAATTAGG - Intergenic
1075380752 10:122016692-122016714 AGGCATTTAGAGATGTCTTTGGG - Intronic
1075436700 10:122449829-122449851 AGAGATGTATAGATGTAATAGGG + Intergenic
1075572718 10:123557397-123557419 AGGCATTGAGAGGTGAAGTAGGG + Intergenic
1078713674 11:13818884-13818906 AGGCAATTATAGAAGAAGAAAGG + Intergenic
1079389314 11:20007260-20007282 AGGGCTTTATTGGTGTAGTAAGG + Intronic
1080480416 11:32643074-32643096 ATGGATTTATATATGTAATATGG - Intronic
1086036813 11:82425603-82425625 AGGCCTTTAGAGATGTGGTAAGG - Intergenic
1087063686 11:94008256-94008278 AGGCACGTACACATGTAGTATGG - Intergenic
1088187148 11:107183432-107183454 AGGCATGTAAAGAGGTAGTATGG + Intergenic
1089136709 11:116255034-116255056 AGGCCTTTAGAGATGTAATAAGG - Intergenic
1091769224 12:3140565-3140587 AGGGATTTTTAGATTTGGTATGG + Intronic
1093774747 12:23060328-23060350 AGGCTTTTATAGAGTCAGTATGG - Intergenic
1093910777 12:24744399-24744421 AGGCATTTTAAGATGTTGTCAGG - Intergenic
1097057992 12:56261731-56261753 AGGAAGTTATTGATGTAGAATGG + Intergenic
1098789009 12:74796693-74796715 ATGCATGTATAGTTGTACTATGG + Intergenic
1099518310 12:83626890-83626912 AGGTGTATATAGATGAAGTATGG - Intergenic
1103869100 12:124078354-124078376 AGGCATTTATAGCGGGAGTGAGG + Intronic
1103887068 12:124210498-124210520 AGGCATTTACAGATGTAATTAGG - Intronic
1104515815 12:129425590-129425612 AGGCATTTTAGGATGTATTAGGG - Intronic
1105681975 13:22737255-22737277 AGGAAATTAAAGATGAAGTAGGG - Intergenic
1106613794 13:31308432-31308454 TGGCATTTATAGGTGGAGTCTGG + Intronic
1106655149 13:31735331-31735353 AAGAATTTATAGATATAGCAAGG - Intergenic
1109895427 13:68681276-68681298 AGGCATATATAGAATTAGAAGGG + Intergenic
1111114235 13:83754862-83754884 AGGAATCTAGAGATGTAGTCTGG - Intergenic
1112272503 13:97981956-97981978 ATTCATTTATCTATGTAGTAAGG + Intronic
1112782635 13:102917526-102917548 AGGCATTTATAGTACAAGTATGG + Intergenic
1115186696 14:30696931-30696953 AGGAATTTATAAATATAGAAAGG + Intronic
1115347365 14:32357453-32357475 AAACATTTATAGATGTGATATGG - Intronic
1119338976 14:73859124-73859146 AGGCATTTGTTGATGAAATAAGG + Intronic
1120034348 14:79679617-79679639 AGGGAATTATAGAAGTAGAATGG + Intronic
1124204201 15:27703442-27703464 AGCTATTTATACTTGTAGTAAGG + Intergenic
1125399864 15:39290466-39290488 AGGCATTTTTAAAAATAGTATGG + Intergenic
1125692544 15:41608077-41608099 AGACATTTAGAGATATAATAAGG - Intergenic
1130140078 15:81218417-81218439 TTGCATTTATAGATGAATTAGGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1134213033 16:12294220-12294242 TAGCATTTATAGATCAAGTAGGG + Intronic
1135194566 16:20383824-20383846 AGGCATTCATGGATGCAGGATGG - Intronic
1137451219 16:48576481-48576503 GGAGATTTACAGATGTAGTAGGG - Intronic
1137453361 16:48598041-48598063 TGGCATTTATAGAGGGAGTTGGG - Intronic
1140150990 16:72365380-72365402 AGGTATTTATATATCTGGTATGG + Intergenic
1141291408 16:82721423-82721445 AGGCAGTTAAAGAGGGAGTAGGG + Intronic
1142368160 16:89661580-89661602 AAGCATATACAGAAGTAGTAGGG - Intronic
1142591745 17:1009287-1009309 AGCCATTTCTAGATGCAGTGGGG - Intronic
1142960489 17:3549427-3549449 AGGAATGTATAGCTGTAGGATGG - Intronic
1143217630 17:5236897-5236919 AGGCATTGTTAGAAATAGTAGGG - Intergenic
1146024105 17:29304515-29304537 ATGCTTTTATACCTGTAGTAGGG - Intergenic
1147849937 17:43434349-43434371 AGGGATTTAAAGATGTGATAAGG - Intergenic
1149946860 17:60937593-60937615 AGGAATTTCTAAATGTAGGAAGG - Intronic
1150910626 17:69383903-69383925 AGGCATTTATAGCTGAATTGAGG - Intergenic
1155099111 18:22590927-22590949 AGGCATTAATAAATCTAGGAAGG + Intergenic
1155833695 18:30550820-30550842 AGACATTTAAAAATGTATTAGGG - Intergenic
1156234472 18:35188196-35188218 AGGCCTTTAAAGAGGTAGTTAGG - Intergenic
1156334068 18:36152593-36152615 TGGCATTTATAGATGATGTTAGG + Intronic
1158904115 18:61995097-61995119 AGGCTCTCAAAGATGTAGTAAGG - Intergenic
1160091275 18:75829139-75829161 ACGCATTTAAAGATGAAATAAGG - Intergenic
1162156250 19:8679769-8679791 AAACATTTATAGATGTATAAGGG - Intergenic
1164124865 19:22304011-22304033 AGGGATTTATAAGTGTAGAAAGG + Intronic
1168604731 19:57749418-57749440 AGGCATTCATAGAATTATTAGGG + Intronic
925704939 2:6675584-6675606 AGGCAATTAGAGATGTCCTAAGG - Intergenic
926313865 2:11695514-11695536 AGGCATCTAGAGATGCAGTCAGG + Intronic
926418437 2:12673861-12673883 AGGCTTTTGTAGGTTTAGTAGGG - Intergenic
926661831 2:15475400-15475422 AGTCATTTAAAAATGTAGAATGG - Intronic
929632814 2:43482805-43482827 AGGCAATTAGAGATATAGTTTGG - Intronic
930166975 2:48212541-48212563 AGGCATTTAGAAAAGTAGTCAGG - Intergenic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937479972 2:122247901-122247923 ATGCATTTATAGATGTTAAAGGG - Intergenic
940967809 2:159859612-159859634 AGGCATTTATAGAAATAGAAAGG - Intronic
941298522 2:163771770-163771792 AAGTATTCATAGACGTAGTAAGG - Intergenic
941536044 2:166723189-166723211 AGAGATTTACAGAAGTAGTAAGG - Intergenic
942714741 2:178879433-178879455 AGGCATGTATAAATGGAATATGG - Intronic
943932533 2:193872389-193872411 AAGTATTTATAGATATATTATGG + Intergenic
944853001 2:203739349-203739371 AGGCATTTATAGAATTTGTTGGG - Intergenic
945614726 2:212053542-212053564 AGGCATTTTTAGAATTACTATGG - Intronic
1169397024 20:5241426-5241448 AGGAATCTAGAGAGGTAGTATGG + Intergenic
1172424613 20:34846778-34846800 AGGAATTTAGAGAAGTAGCAAGG - Intronic
1175685485 20:61024993-61025015 AGGTCTTTATAGATGTAATTAGG - Intergenic
1177911444 21:27038890-27038912 TGGCATTTATAGGGGTAGTTGGG - Intergenic
1183106460 22:35618596-35618618 AGGGATTGATAGATGTTGGATGG - Intronic
1183189662 22:36313771-36313793 AGCCATGCATGGATGTAGTAAGG - Intronic
949372322 3:3348899-3348921 AGGCATTTAGAGATGTTGAGTGG - Intergenic
949756741 3:7420667-7420689 AGCCATTTATAGAGGTAGGTAGG - Intronic
950433312 3:12964114-12964136 TGGCATTTATGGTTGAAGTATGG - Intronic
952704575 3:36364523-36364545 TGGCATTTATAGGTGGAGTCAGG - Intergenic
953862295 3:46555021-46555043 AGGCATTTATAGATCTTCTTTGG + Intronic
955529552 3:59858803-59858825 AGGTATTTATAAATGTGGAAGGG + Intronic
955841928 3:63121865-63121887 AGGCATTTATACCGGAAGTATGG - Intergenic
958109985 3:89130137-89130159 AGGCACTTTTACATTTAGTAGGG + Intronic
958946321 3:100366401-100366423 AGGTATATATATATATAGTAGGG - Intronic
967443429 3:189536412-189536434 AGGCATTTTTAGAAGTGGTGGGG - Intergenic
968876927 4:3274951-3274973 AGGTAATTATTGATGTAGTTGGG + Intergenic
971939436 4:33196389-33196411 ATGCATTTTTAGAAGTAGGATGG + Intergenic
974431879 4:61808859-61808881 TGGCATTTTTAAATGTAGTATGG + Intronic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
978377150 4:108086625-108086647 ATGCATTAATATATGTACTACGG + Intronic
978724379 4:111953151-111953173 ATGCATTTATTGATTGAGTATGG - Intergenic
979037307 4:115738374-115738396 AAGCTTTAAAAGATGTAGTAAGG - Intergenic
980545996 4:134262236-134262258 ATTCATTTATAGACGTAGAAAGG - Intergenic
983289898 4:165789016-165789038 ACACATTTATAAATGTATTAGGG + Intergenic
987103759 5:14616875-14616897 AGGAATTTTTAGATGTAGTCAGG + Intergenic
990124789 5:52500989-52501011 AGTAATTTATAGTTGGAGTAAGG + Intergenic
993228558 5:85202878-85202900 AGGCCTTTATAAATATAGAAAGG - Intergenic
1000773369 5:165385275-165385297 TGACATGTATAAATGTAGTATGG + Intergenic
1001389079 5:171364295-171364317 TGGCTTTTATATATGTATTATGG + Intergenic
1004521956 6:16369615-16369637 AGGCATTTAAAGATGTGCAAAGG + Intronic
1007315284 6:40983280-40983302 AGGCATTTAGAGAGATGGTAAGG - Intergenic
1010967434 6:82227757-82227779 AGCCATTTATACATGGCGTAGGG + Intronic
1013390070 6:109677574-109677596 AGGCATGTATATATTTAGCAGGG - Intronic
1014923452 6:127240652-127240674 AGATATTTATAGATGTATGAAGG + Intergenic
1016448698 6:144158599-144158621 AAGCATTCATAAATGTAGGATGG + Intronic
1016448707 6:144158739-144158761 AAGCATTCATAAATGTAGGATGG + Intronic
1016556483 6:145344222-145344244 AAGCATTAATAAATGTAGAAAGG + Intergenic
1019848428 7:3529087-3529109 AGGGATTTATAAATGTGGAAAGG + Intronic
1021312500 7:19111340-19111362 AGGAATATATAGATGTATAAGGG - Intronic
1022780978 7:33582888-33582910 AGGCAGGAATAGATGTGGTATGG - Intronic
1023495645 7:40793041-40793063 AGGCATATATGAATGTTGTATGG - Intronic
1024014403 7:45297828-45297850 AGGCAATGATAGATGAATTAAGG - Intergenic
1027756797 7:82223994-82224016 AGGGATCTTTAGATGTAGGAAGG - Intronic
1028069979 7:86439949-86439971 AGGAATTTAAAGATCTGGTATGG + Intergenic
1028241022 7:88420732-88420754 AGGCATTTAAAAATGTATCAAGG + Intergenic
1028957536 7:96710662-96710684 TGGCATTTATAGATATAATCTGG - Intergenic
1029984260 7:104908013-104908035 AGGGTGTTATGGATGTAGTAGGG - Intergenic
1030717025 7:112820639-112820661 AGGCATTTATTAATGTGGAAAGG + Exonic
1032998878 7:137480914-137480936 AGGCATTTATAGATGTAGTAGGG - Intronic
1033404202 7:141056133-141056155 AGTCATTTATAGATTTAATACGG - Intergenic
1033984165 7:147202465-147202487 AAACATTTATAGATGAAGAAAGG + Intronic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1036060869 8:5318821-5318843 AGGCTTCTATAGAGTTAGTAGGG - Intergenic
1037645365 8:20787888-20787910 AGGCATTTAAAGATGGGGAAGGG + Intergenic
1038160058 8:25027984-25028006 AGGCATTGAGAGATGAAGAAGGG + Intergenic
1038365266 8:26925368-26925390 AGTCATTTTCACATGTAGTAAGG - Intergenic
1038559493 8:28559482-28559504 AGGCATATATATATATAGTAGGG + Intronic
1044175034 8:89109372-89109394 AGGCAGTTATAGAAGAAATATGG + Intergenic
1045575223 8:103413361-103413383 AGGTACTTATAGAGGTAATACGG + Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050637431 9:7626938-7626960 AGGAATTTAGAGATGCAGTCTGG - Intergenic
1051425865 9:16930858-16930880 AGGCATTTTAAAATGTACTAGGG + Intergenic
1052096562 9:24391194-24391216 AGGAATTTACAGAAGTAGTCTGG + Intergenic
1053652173 9:40179804-40179826 TGGCATTTAGACATGTAGGAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053902566 9:42809118-42809140 TGGCATTTAGACATGTAGGAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054532410 9:66196401-66196423 TGGCATTTAGACATGTAGGAAGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1057997623 9:99833635-99833657 AGGCATTTAGAGATTCAATAAGG - Intronic
1058434866 9:104953121-104953143 AGCCATTTATAGGTGTAGACAGG - Intergenic
1185885709 X:3780714-3780736 AGGCATTTATAGTCTTAGGAGGG + Intergenic
1187484500 X:19689557-19689579 AGGCAATTTGAGATGTAGTCTGG + Intronic
1188588218 X:31802751-31802773 AGGCAGTTAAATATGCAGTATGG + Intronic
1196374930 X:115023253-115023275 AGGCATTTATACATGTTGGATGG - Intergenic
1200704848 Y:6433829-6433851 AGGCATGCCTAGATGTTGTAGGG - Intergenic
1200888956 Y:8301624-8301646 TGGCATTTAAAGATATACTATGG - Intergenic
1201029263 Y:9730879-9730901 AGGCATGCCTAGATGTTGTAGGG + Intergenic