ID: 1033004396

View in Genome Browser
Species Human (GRCh38)
Location 7:137545894-137545916
Sequence ACTCACATGGTGAAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033004390_1033004396 27 Left 1033004390 7:137545844-137545866 CCCTGAGGAGACGAGGCTGGGGA 0: 1
1: 0
2: 2
3: 25
4: 286
Right 1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 199
1033004391_1033004396 26 Left 1033004391 7:137545845-137545867 CCTGAGGAGACGAGGCTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 365
Right 1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG 0: 1
1: 0
2: 3
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033004396 Original CRISPR ACTCACATGGTGAAGGAGCC GGG Intronic
902296338 1:15469772-15469794 ACCCACATGTCAAAGGAGCCTGG + Intronic
903000128 1:20259318-20259340 TCTCACATAGTGAAGAACCCAGG + Intergenic
904807956 1:33145023-33145045 AGTCACACAGTGATGGAGCCTGG + Intergenic
907223793 1:52926853-52926875 ACGCAGCTGGTGACGGAGCCTGG + Intronic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
907372808 1:54014131-54014153 AGTCACCTGGTGGAGAAGCCAGG + Intronic
909589901 1:77335939-77335961 ACTCACATGGTGAAAGGGACAGG + Intronic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
912439216 1:109686142-109686164 ACACACATGGGTCAGGAGCCAGG + Intronic
912442532 1:109710584-109710606 ACACACATGGGTCAGGAGCCAGG + Intergenic
913637883 1:120782099-120782121 ACTAAAAAGGTGAAGAAGCCTGG + Intergenic
914280829 1:146170886-146170908 ACTAAAAAGGTGAAGAAGCCTGG - Intronic
914541872 1:148621825-148621847 ACTAAAAAGGTGAAGAAGCCTGG - Intronic
914624771 1:149449422-149449444 ACTAAAAAGGTGAAGAAGCCTGG + Intergenic
914705243 1:150164729-150164751 ACTCATATTGCAAAGGAGCCTGG - Intergenic
916240294 1:162632504-162632526 ACTTTGCTGGTGAAGGAGCCCGG - Exonic
916979803 1:170121767-170121789 ACTCACATGATTATGGAGACTGG - Intergenic
918904302 1:190473576-190473598 GCTAACATGTTGAAGGAGCCTGG - Intronic
919102329 1:193109922-193109944 ACTCACATGATTATGGAGGCTGG - Intergenic
919759931 1:201091554-201091576 CCCTACCTGGTGAAGGAGCCCGG - Intronic
920276767 1:204812012-204812034 AGTCACATGGGGAAGCAGCAGGG - Intergenic
921189497 1:212697225-212697247 ACTCACATGGTGAGTGCTCCTGG - Intronic
923812081 1:237329789-237329811 ACTCAGGAGGTGAAGGAACCAGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1065547588 10:26837435-26837457 AGTCACATGGTGGGGGAGACGGG + Intronic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1070372784 10:75801065-75801087 TCTGACATGGTGAAGGCGCTTGG - Intronic
1070453140 10:76581951-76581973 GCTCACCTGGTGGGGGAGCCTGG + Intergenic
1070909020 10:80101131-80101153 ACTGTCATGCTGAAGGAGTCAGG - Intergenic
1071353174 10:84767159-84767181 ACTGCCATGGGGTAGGAGCCCGG - Intergenic
1071433559 10:85625688-85625710 ATTGACATGGTGAGGGAGTCTGG + Intronic
1074149570 10:110746145-110746167 AATCTCATGCTGAAGGAGGCTGG + Intronic
1074484931 10:113866753-113866775 TCAAACCTGGTGAAGGAGCCGGG - Intronic
1077858288 11:6151453-6151475 AATCAGAAAGTGAAGGAGCCAGG + Intergenic
1078102841 11:8339864-8339886 ACTCACCTGGTGGAGGGGCGTGG - Intergenic
1078270465 11:9789821-9789843 ACTGACTTGGAGAAGTAGCCTGG + Intronic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1081456983 11:43233389-43233411 ACTCAGAAGGTCCAGGAGCCAGG + Intergenic
1084603634 11:70160618-70160640 ACTCCCCTGGTAAAGGAGGCAGG - Intronic
1089127547 11:116187481-116187503 AGTCACAGGGAGAAGCAGCCTGG + Intergenic
1089766865 11:120774388-120774410 GCTCACATGGTTATGGAGACTGG + Intronic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1090748820 11:129728467-129728489 ATTCTCATGGAGAAGCAGCCAGG + Intergenic
1091464578 12:672715-672737 ACACAGCTGGTGATGGAGCCAGG + Intergenic
1092004630 12:5058893-5058915 ATACACAGGGTGAATGAGCCAGG - Intergenic
1094706156 12:32916110-32916132 ACTCACAGGGGGAAGGAACTTGG + Intergenic
1096658286 12:53105227-53105249 ACTCACCTGCTCAAGGAACCTGG - Exonic
1097114559 12:56687992-56688014 ACTCACATTGTGAACGGGGCAGG + Exonic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1101224374 12:102673184-102673206 ACTCATATGCTTATGGAGCCAGG + Intergenic
1101353033 12:103950431-103950453 ACTCACGTGCTGAAGTGGCCAGG + Exonic
1101533727 12:105598296-105598318 ACTCACATAATGAAGAAGTCCGG + Intergenic
1102204604 12:111081970-111081992 CCTCTCAGGGTGAGGGAGCCGGG - Intronic
1102414396 12:112748003-112748025 ACTCACATTCTGATGGAGACAGG + Intronic
1106693977 13:32150737-32150759 ACTGACAGAATGAAGGAGCCAGG - Intronic
1107065389 13:36209523-36209545 TCTCACATGGTGGAGAAGCAAGG + Intronic
1109752884 13:66719445-66719467 CCTCACATGGTGGAGGGCCCAGG - Intronic
1111850861 13:93572994-93573016 ACTGAAGTGGTGAAGGAGGCAGG + Intronic
1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG + Intronic
1113397664 13:109963625-109963647 ACCCACAAGGGGAAGGGGCCAGG - Intergenic
1114040564 14:18674476-18674498 ACTGTCATGCTGAAGGAGTCAGG - Intergenic
1114045601 14:18872987-18873009 ACTGTCATGCTGAAGGAGTCAGG - Intergenic
1114118611 14:19646481-19646503 ACTGTCATGCTGAAGGAGTCAGG + Intergenic
1114267721 14:21082462-21082484 ACTCACGTGGCGAAGGAAGCAGG - Exonic
1114837289 14:26217995-26218017 ACACACTTTGGGAAGGAGCCAGG - Intergenic
1115095725 14:29633356-29633378 AATCCCATGCTGATGGAGCCAGG + Intronic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1116788230 14:49311275-49311297 ACTCCAGTGGTGTAGGAGCCTGG - Intergenic
1117496345 14:56309284-56309306 ACTCACAAGGGGAAGGGCCCTGG - Intergenic
1117593022 14:57295209-57295231 ACTTACTTGGTGAAGCTGCCAGG + Exonic
1118731852 14:68672427-68672449 ACTCCAATGGTAAAGGAGCTGGG + Intronic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1121018346 14:90562279-90562301 AGGCACATGGTTCAGGAGCCTGG - Intronic
1121653015 14:95573909-95573931 ACCCAGATGGCAAAGGAGCCCGG - Intergenic
1123000424 14:105291098-105291120 ACTGACATGTGGAAGGGGCCAGG + Intronic
1124695585 15:31861901-31861923 ACTGCCATGGTGAAGGACACAGG - Intronic
1124829528 15:33134504-33134526 ACTCCCATAGTGCAGCAGCCAGG - Intronic
1125483412 15:40095694-40095716 ACTCACATGGTTTAGAAGGCAGG + Intronic
1129673976 15:77622439-77622461 ACTCACCTGGTGGAGTGGCCGGG - Intronic
1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG + Exonic
1129989963 15:79953295-79953317 ACTAAGATGGTGAAGGATTCAGG + Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1132775919 16:1593948-1593970 TCTCCCATGCTGAAGAAGCCCGG - Intronic
1133100878 16:3478861-3478883 ACTCACCTGGTGGAGGAACAGGG + Intronic
1133511605 16:6463660-6463682 AATGACATGGTGAACGAGACCGG - Intronic
1135059005 16:19255160-19255182 ATTCACAGGGTAAAGGAGCTGGG - Intronic
1135485642 16:22862491-22862513 GCTCACATGCTGCAGGAGCCGGG - Intronic
1139044583 16:63041099-63041121 GATCTCATGTTGAAGGAGCCTGG - Intergenic
1139053730 16:63156583-63156605 TATCACATGGTGAGGGAGCTGGG - Intergenic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1140526972 16:75631162-75631184 TCTCACCTTGTCAAGGAGCCTGG + Exonic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1144112467 17:12049428-12049450 ACTCACATGCGAAAGGAGCCAGG - Intronic
1145933078 17:28699877-28699899 ACTCACCTGGTACAGGATCCTGG - Exonic
1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG + Intronic
1146477503 17:33174755-33174777 GCTCATATGGAGATGGAGCCTGG + Intronic
1149635267 17:58162202-58162224 CCTCACATGGCAAAGGAGCAAGG - Intergenic
1150647945 17:66991586-66991608 ACTCACATGGGTAAGGATACGGG + Intronic
1156420852 18:36951159-36951181 ACCCAAATAGTCAAGGAGCCAGG - Intronic
1156969418 18:43137230-43137252 ACCTACATGGTGAAGGAGACAGG - Intergenic
1157477761 18:48034396-48034418 GCACACACGGGGAAGGAGCCAGG - Intronic
1159370099 18:67517586-67517608 ACTCACATGTCGTAGTAGCCGGG - Intergenic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1163415000 19:17181024-17181046 ACTCACAGGATGAAGGCGCGGGG - Exonic
926229237 2:10990322-10990344 ACTGACACGGTGAAGGAGAGAGG + Intergenic
930056604 2:47257174-47257196 GCTCAGATGCTGCAGGAGCCAGG + Intergenic
930901654 2:56514065-56514087 ACTAACATGGGAAAGGAGTCTGG + Intergenic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
932326888 2:70869150-70869172 CATCACATGGTGGAGGGGCCAGG - Intergenic
934526885 2:95057482-95057504 TCTCAAATGTTGAAGAAGCCCGG - Intergenic
937218665 2:120328790-120328812 ACTCACATGATGAAGGACCCAGG - Intergenic
938269621 2:129958071-129958093 ACTGTCATGCTGAAGGAGTCAGG + Intergenic
938768348 2:134479015-134479037 TCTCACATGGGGAAGAAGCAAGG - Intronic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940385205 2:153063636-153063658 TCTCACATGGTGGAAGAGGCAGG - Intergenic
942964703 2:181877387-181877409 ACTCAGCTAGTGGAGGAGCCAGG - Intergenic
945989933 2:216387403-216387425 ACTGAAACAGTGAAGGAGCCAGG - Intergenic
946903351 2:224393617-224393639 ACTCACACAGTGAAGGAGGATGG - Intronic
947202060 2:227622631-227622653 GCTCCCATGGTGATGGAGGCTGG + Intronic
1169832448 20:9839115-9839137 ACACTCAGGGTGCAGGAGCCAGG + Intergenic
1170322335 20:15114083-15114105 ACTCACAGGGTGGAGAAGGCTGG + Intronic
1171955307 20:31457404-31457426 AGCCACCTGGTGAAGGAGTCTGG + Intergenic
1173562226 20:44014201-44014223 ATTCACATGGTGATGGACACAGG + Intronic
1175683885 20:61012264-61012286 ACTCACATGATTATGGAGGCTGG - Intergenic
1177470326 21:21552858-21552880 ACTCACCTAGTGAATGACCCAGG + Intergenic
1178292490 21:31380898-31380920 ACTCACATGTTGAATGACCTGGG + Intronic
1178930234 21:36811881-36811903 ACTCACTTGCTGAAGGATCAGGG + Intronic
1179030837 21:37718218-37718240 AGTCAAGAGGTGAAGGAGCCTGG + Intronic
1179277062 21:39901380-39901402 AGGCACATGGTGACGAAGCCAGG + Intronic
1180464132 22:15595604-15595626 ACTGTCATGCTGAAGGAGTCAGG - Intergenic
1181475839 22:23167318-23167340 ACTCACATTGTGAGGGTGCAGGG - Intergenic
1182090018 22:27588160-27588182 AATCACATAGTTAATGAGCCAGG + Intergenic
1182586921 22:31348830-31348852 ACACAGATAGTGATGGAGCCAGG + Intergenic
1184161366 22:42699378-42699400 ACTAAGATTGTAAAGGAGCCGGG - Intronic
949844808 3:8358420-8358442 ACTCAAATGGTAAAGAGGCCAGG + Intergenic
953071322 3:39523114-39523136 ACTCTCATGATCAAGGTGCCTGG + Intronic
955082724 3:55672912-55672934 ACCAACATGCTGATGGAGCCCGG - Intronic
959838472 3:110948255-110948277 ACAATCATGGTGAAAGAGCCAGG + Intergenic
961057641 3:123802646-123802668 ACGCACAGTGTGAAGGAGCAAGG + Intronic
961084794 3:124057625-124057647 ACTCCCAAGCAGAAGGAGCCTGG + Intergenic
961413668 3:126742062-126742084 ACTCCCTTGGTGAGGGATCCAGG + Intronic
961993184 3:131213990-131214012 CCTCATATGGTGGAGGAGCATGG - Intronic
962313106 3:134339715-134339737 ACTCAGGTGGAGAAGGAGACAGG - Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
967958928 3:194902699-194902721 AATCACAGGGTGAGGGAGACTGG - Intergenic
968292136 3:197547121-197547143 CCTCAAATGGTGAGGGAGCGGGG - Intronic
969256463 4:6005420-6005442 ACACACATTGACAAGGAGCCAGG + Intergenic
969855572 4:9996515-9996537 ACCCACATGGGGGAGGAGCAGGG - Intronic
970805556 4:20026283-20026305 ACTCACATGATAATGGAGACTGG - Intergenic
971734459 4:30428297-30428319 ACTCACATGATGAAGGAGGCTGG - Intergenic
976370001 4:84276728-84276750 ACTCTCTTTGTGATGGAGCCTGG - Intergenic
976473654 4:85457994-85458016 AGTCAGATGGTGAGGAAGCCAGG - Intergenic
984136853 4:175952003-175952025 ACTCACATGATTATGGAGGCTGG - Intronic
985017612 4:185652661-185652683 ATTCACATGGTGCACAAGCCGGG - Exonic
987008154 5:13732337-13732359 TCTCACATAGTGCAGGAGCTGGG + Intronic
988857647 5:35244886-35244908 ACCCAAATGGAGAAGGAGCTGGG + Intergenic
990150928 5:52816571-52816593 ACTCACAGGCTGAAGGAGTGTGG + Intronic
992888552 5:81183159-81183181 TCTCACATGGTGAACTACCCAGG + Intronic
997632928 5:135383569-135383591 AATCACACGGGAAAGGAGCCAGG - Intronic
1004210141 6:13632229-13632251 TCTCAGATGGGCAAGGAGCCAGG + Intronic
1005492400 6:26358973-26358995 CCTCACATTGTGAGGGGGCCTGG + Intergenic
1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG + Intergenic
1008838131 6:55863031-55863053 AATCACAGGGCAAAGGAGCCAGG - Intronic
1009934366 6:70216842-70216864 CCACGCCTGGTGAAGGAGCCTGG - Exonic
1012215083 6:96572669-96572691 GCCCACATGGTGAAGCTGCCTGG - Intronic
1012480689 6:99663770-99663792 ACTCACCTGGAGAAGCAGCAAGG - Intergenic
1012625006 6:101393867-101393889 AAACACCTCGTGAAGGAGCCCGG - Intergenic
1016550294 6:145271958-145271980 ACTCACATGATTATGGAGGCTGG + Intergenic
1017442935 6:154480532-154480554 AATCGCATGGAGAATGAGCCAGG - Intronic
1021002428 7:15349280-15349302 ACTCAGATCGTTAGGGAGCCTGG - Intronic
1021092438 7:16499516-16499538 ACTCTCATGGGGAAGGAGGATGG - Intronic
1021538679 7:21732992-21733014 CCTCACATCCTGCAGGAGCCAGG + Intronic
1021604362 7:22395289-22395311 ACTCACATGGAGGAGGGCCCAGG - Intergenic
1022415118 7:30170812-30170834 GCTCACATGGTGACAGAGCTGGG + Intergenic
1022846925 7:34219657-34219679 AGTTACATGGTTAAGAAGCCAGG - Intergenic
1023250294 7:38252994-38253016 ACTCTTGTTGTGAAGGAGCCCGG - Intergenic
1023251605 7:38269105-38269127 ACTCTTGTTGTGAAGGAGCCCGG - Intergenic
1023301896 7:38782184-38782206 ACTCACACTGTGGAGCAGCCAGG - Intronic
1023709056 7:42972643-42972665 AACAACATGATGAAGGAGCCAGG - Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024794617 7:53006507-53006529 GCTCACATTGTGGAGGGGCCGGG + Intergenic
1027981219 7:85225403-85225425 ACTCACTTGGAGATGCAGCCTGG + Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1032792503 7:135252885-135252907 ATTCACATGGTGTAGGGGCAAGG + Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1034125628 7:148668947-148668969 ACTGAAATGGTGAAGGATCTGGG - Intergenic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1037765698 8:21770940-21770962 ATTCACAGGGTCATGGAGCCTGG + Intronic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1044735363 8:95273188-95273210 ATTAACATGGTAAAGGAGACCGG + Intergenic
1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG + Intergenic
1046313757 8:112473760-112473782 ACTCCAAGGGTGAAGGAGCAGGG - Intronic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1048704990 8:137143642-137143664 AATCACATGGTGAGAGAGCAAGG - Intergenic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1049251386 8:141590998-141591020 ACTCAGAAGGGGAGGGAGCCAGG - Intergenic
1055235311 9:74115216-74115238 ACTCTCAGGGTGATGGAACCAGG + Intergenic
1055798867 9:80009192-80009214 GCTCACATGATTATGGAGCCTGG + Intergenic
1056266489 9:84901766-84901788 ACATACATGGAGAAGAAGCCAGG - Intronic
1056528918 9:87469821-87469843 CCACCCATGGTGAAGGAGCTAGG + Intergenic
1057581764 9:96293468-96293490 ACGCACATGGTTATGGAGGCTGG - Intronic
1059009582 9:110442052-110442074 ACTAATTTAGTGAAGGAGCCTGG - Intronic
1059353088 9:113679424-113679446 ACTCACCTGGCAAAGGACCCTGG + Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1061388286 9:130303199-130303221 CATCAGCTGGTGAAGGAGCCGGG + Intronic
1061728892 9:132597972-132597994 ACTAACATGATGAAATAGCCAGG - Intronic
1061978496 9:134086057-134086079 AAGCCCATGGGGAAGGAGCCAGG - Intergenic
1185716363 X:2345886-2345908 GCTCATATGGTGATGGAGGCTGG - Intronic
1185940060 X:4307956-4307978 ATTTACAGGGAGAAGGAGCCTGG + Intergenic
1189033646 X:37474545-37474567 ACTCCCATGGTGAACATGCCTGG - Intronic
1189236283 X:39489661-39489683 ACTCACCTGATGAAGGAGGCAGG + Intergenic
1189387343 X:40548230-40548252 ACTCTCATGGAGATGGAGCCTGG + Intergenic
1190561901 X:51694723-51694745 ACTCACGTGATGATGGAGGCTGG + Intergenic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic