ID: 1033007169

View in Genome Browser
Species Human (GRCh38)
Location 7:137578725-137578747
Sequence TTATCTCAGCCCGATATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033007169_1033007174 0 Left 1033007169 7:137578725-137578747 CCAGGGATATCGGGCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1033007174 7:137578748-137578770 CAGGAAAAGGTGGAAGAAGGTGG No data
1033007169_1033007173 -3 Left 1033007169 7:137578725-137578747 CCAGGGATATCGGGCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1033007173 7:137578745-137578767 TAACAGGAAAAGGTGGAAGAAGG 0: 1
1: 0
2: 5
3: 63
4: 604
1033007169_1033007172 -10 Left 1033007169 7:137578725-137578747 CCAGGGATATCGGGCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1033007172 7:137578738-137578760 GCTGAGATAACAGGAAAAGGTGG 0: 1
1: 1
2: 2
3: 46
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033007169 Original CRISPR TTATCTCAGCCCGATATCCC TGG (reversed) Intronic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
903519600 1:23936621-23936643 TTAGCTCAGCCCCAAAGCCCAGG - Intergenic
922154544 1:223030791-223030813 TTAGCTCAGCCCAAAAGCCCAGG + Intergenic
1070982798 10:80663206-80663228 TTTTCTCAGCCCTAGTTCCCTGG + Intergenic
1071011784 10:80948841-80948863 TTAGTTCAGCCCAATAACCCAGG - Intergenic
1072983236 10:100117237-100117259 CTATCTCAGTCAGATTTCCCAGG + Intergenic
1073095489 10:100977192-100977214 TGCTCTCCACCCGATATCCCAGG - Intronic
1078579828 11:12530220-12530242 TTGTCTCAGCCCAGAATCCCAGG + Exonic
1079998945 11:27325698-27325720 TCATCTCAGCCCAAAATCTCAGG + Intergenic
1082111896 11:48286148-48286170 TAACCTCAGGCCAATATCCCTGG - Intergenic
1083390909 11:62349356-62349378 TTAGCTCTGCCCAATAGCCCAGG + Intronic
1085474276 11:76780098-76780120 TTTGATCACCCCGATATCCCTGG + Intergenic
1089189387 11:116643137-116643159 TCATGTCAGCCTGATCTCCCAGG + Intergenic
1095475639 12:42584764-42584786 TTATCTGAGGCAGAGATCCCTGG - Intronic
1096624783 12:52887950-52887972 ATATCTCAGCCCTGCATCCCAGG + Intergenic
1100306339 12:93353205-93353227 TTATGTCAGCCCAGTCTCCCAGG - Intergenic
1101627524 12:106460159-106460181 TTATTTCAGCTCTATATCGCTGG - Intronic
1104440931 12:128792423-128792445 TTATCTCATCACAATATCACAGG + Intergenic
1110997598 13:82132941-82132963 AAACCTCAGGCCGATATCCCTGG - Intergenic
1127292541 15:57583181-57583203 GTAGCTCAGCCCCAAATCCCTGG - Intergenic
1131629209 15:94158058-94158080 TTTTTTCAGCCTGATATGCCAGG + Intergenic
1132273364 15:100545073-100545095 TTATCTCAGCCAGCAAGCCCAGG + Intergenic
1133664901 16:7957373-7957395 TTATCTCTGCCTAATAGCCCTGG - Intergenic
1137463703 16:48689083-48689105 TTGTCTCATCCAGGTATCCCAGG + Intergenic
1143134266 17:4702557-4702579 CTATCTCAGCCCAATATCAGAGG - Intronic
1147847659 17:43416358-43416380 TTATCTCAGCCCATCATGCCTGG + Intergenic
1148770023 17:50061176-50061198 TAATCCCAGCCCTACATCCCAGG - Intronic
1149409012 17:56384581-56384603 TTGTCTCAGCCCAAAATCTCAGG + Intronic
1151242386 17:72768332-72768354 TTAGCTCAGCCCAAAAGCCCAGG + Intronic
1160166107 18:76513818-76513840 TTATCTCAGCCAGATCTTCTGGG + Intergenic
1160761021 19:784538-784560 TTCTCTCACCTCGACATCCCAGG + Intergenic
1162294528 19:9804015-9804037 TTACCTCAGCCCAATAGCCCAGG + Intergenic
1165459418 19:35935814-35935836 TTATCTCAGCACCACCTCCCTGG - Intronic
1167600725 19:50453306-50453328 TTATCTCAGCCAGAGCACCCTGG - Intronic
1168444475 19:56399969-56399991 TTAGCTCAGCCCTATAGCCCAGG + Intronic
926457120 2:13080587-13080609 ATATCTCAGCCAGTTTTCCCAGG - Intergenic
928988781 2:37208466-37208488 TTAAACCAGCCCTATATCCCTGG - Intronic
932030348 2:68177425-68177447 TTCTCTCAGGCCCATCTCCCAGG - Intronic
936740892 2:115507125-115507147 TTATTTCAGCCAGATATATCAGG - Intronic
941858562 2:170254672-170254694 AGATCTCAGCTCAATATCCCTGG - Intronic
942727855 2:179029088-179029110 TTGTCTCAGCCAAATATCTCAGG + Intronic
1168768337 20:397271-397293 TTATCTCTGGCCCAAATCCCAGG - Exonic
1170734454 20:19002107-19002129 TTTTCCAAGCACGATATCCCAGG - Intergenic
1172539851 20:35702842-35702864 TGATCTCAGCTCCATCTCCCAGG - Intergenic
1172754937 20:37276942-37276964 CCATCTCAGCCCCACATCCCTGG - Intergenic
1179254964 21:39707606-39707628 TTAGCTCAGCCCAGTAGCCCAGG + Intergenic
950217652 3:11170713-11170735 TTATCTCAGCCTGAAGACCCTGG + Intronic
958762543 3:98326609-98326631 TTAGTTCAGCCCAAAATCCCAGG - Intergenic
962752695 3:138445442-138445464 TTATCTGAGCCACAGATCCCTGG + Intronic
963191168 3:142475003-142475025 TTATGTCACCCCTCTATCCCTGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967243658 3:187465755-187465777 TTAGCTCAGCCCAACAGCCCAGG + Intergenic
971329435 4:25670468-25670490 TCATCTCAGCCCCTTCTCCCTGG + Intronic
997580878 5:135016132-135016154 TTATCTCAGGCCCTGATCCCAGG - Intergenic
998812344 5:145978905-145978927 TTAGCTCTGGCAGATATCCCAGG - Intronic
1002661634 5:180794784-180794806 TTATAACAGCCTGTTATCCCTGG - Intronic
1003942438 6:11043539-11043561 CTCTCTCTGCCCGATTTCCCAGG - Intronic
1005293824 6:24403926-24403948 TTTTCTCAATCCGATCTCCCTGG - Intronic
1007791474 6:44311392-44311414 TAAGCTCAGCCAGATGTCCCTGG + Exonic
1012426180 6:99117174-99117196 TTGTCTCTGCCAAATATCCCTGG - Intergenic
1016376695 6:143428657-143428679 CTTCCTCAGCCCGATATCCAGGG + Exonic
1018138864 6:160806862-160806884 TTAGCTCAGCCCAGTAGCCCAGG - Intergenic
1019023543 6:168939460-168939482 TTCTCTCTGCCCTTTATCCCAGG + Intergenic
1020695867 7:11413569-11413591 TTAGCTCACCCCGAAAACCCAGG - Intronic
1021691944 7:23239221-23239243 TTTTCTCTGACCGATTTCCCAGG - Intronic
1030122053 7:106119777-106119799 TTAACTCAGCCCAAAAGCCCTGG - Intergenic
1033007169 7:137578725-137578747 TTATCTCAGCCCGATATCCCTGG - Intronic
1052986021 9:34488681-34488703 TTTTCTCAGCTTTATATCCCAGG + Intronic
1056657247 9:88519650-88519672 TTAGCTCAGCCCAATAACCCAGG - Intergenic
1060253996 9:122010373-122010395 TTATTTCAGCCCTCTATCTCAGG + Intronic
1061824493 9:133249205-133249227 TTAGCTCAGCCCAAAAGCCCAGG - Intergenic
1185617822 X:1433991-1434013 CAATCCCAGCCCCATATCCCTGG - Intronic
1189048364 X:37617639-37617661 TAATCTCAGCCCAATATTCCAGG + Intronic
1196551705 X:117035144-117035166 ATATCTCAGCCTGATATTCAAGG + Intergenic
1196933322 X:120703886-120703908 TTACCTCAGTCAGATATCTCTGG + Intergenic