ID: 1033009652

View in Genome Browser
Species Human (GRCh38)
Location 7:137607106-137607128
Sequence CCTTTTCCTGCTCTTTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 692}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033009652 Original CRISPR CCTTTTCCTGCTCTTTACTG TGG (reversed) Intronic
901787033 1:11631600-11631622 CCTTTACCTGGTCTTCTCTGGGG - Intergenic
902083842 1:13841214-13841236 CCTTTTCCCACTTTTTAATGGGG + Intergenic
902364211 1:15960527-15960549 CCTTTTCCTGGTCTTTTTTCAGG - Intronic
902799427 1:18820047-18820069 CAGTTTCCTCCTCTGTACTGTGG + Intergenic
904144881 1:28382067-28382089 CCTTTGCCTACTCTTTAATGGGG + Intronic
904300169 1:29549084-29549106 CCTCTTCCTGGTCCTCACTGGGG + Intergenic
904443964 1:30552444-30552466 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
905357437 1:37394676-37394698 CCTCTTCATGCTCCTTGCTGGGG - Intergenic
905416942 1:37810144-37810166 CCTTTTCCTGCTGTGTTCTCAGG - Exonic
905765721 1:40598790-40598812 CCTTTGCCAACTCTTTAATGGGG + Intergenic
905918784 1:41705109-41705131 CCTTTTTATGCCCTTTACAGAGG + Intronic
905962452 1:42055416-42055438 CCTTTTCCTCATCTTTAATGTGG - Intergenic
906007572 1:42489860-42489882 GCTTTTCCTGTTGTTTACAGTGG + Intronic
906855872 1:49303810-49303832 CCTTTGCCTGCTTTTTAATGGGG + Intronic
906994083 1:50771436-50771458 CCTTTGCCTACTTTTTAATGGGG - Intronic
907063403 1:51454369-51454391 CCTTTTCCTACTCTATTCTCTGG - Intronic
907139356 1:52171822-52171844 CCTTTGCCTGCTTTTTGATGGGG + Intronic
908226697 1:62062834-62062856 CCTTTGCCTGCTGTTTAATATGG + Intronic
908573128 1:65430119-65430141 CCATTTCATGCTCATTACTTAGG + Intronic
908929549 1:69302347-69302369 ATTTTTCCTGCTCTTCACTTTGG - Intergenic
909503828 1:76364649-76364671 CTTTTGCCTGCTTTTTAATGAGG - Intronic
909769651 1:79404777-79404799 TCTTGTTCTGTTCTTTACTGTGG + Intergenic
910096614 1:83529869-83529891 CCTTTGCCTACTTTTTAATGGGG - Intergenic
911885977 1:103300099-103300121 CATTTTCCTGCTCTTGATTCTGG - Intergenic
912044624 1:105438154-105438176 CCTTTTCCTGAGTTTTACTTGGG - Intergenic
912205548 1:107504537-107504559 CCTTTGCCTACTTTTTAATGGGG - Intergenic
912223194 1:107701125-107701147 CCTTTGCCTGCTTTTTAATGGGG + Intronic
912472190 1:109913412-109913434 TCTCTTCCTTCTCTTCACTGGGG - Intronic
913162811 1:116160806-116160828 CCCTTTCCAGCTTTTTTCTGGGG - Intergenic
913163214 1:116164219-116164241 TCACTTCCTGCTCTTTCCTGTGG + Intergenic
913391003 1:118312358-118312380 CCTTTTCCTGACCTTTAAGGAGG - Intergenic
913610043 1:120502043-120502065 CCTTTTCCAGCTCTTGAAGGTGG + Intergenic
914581145 1:149020199-149020221 CCTTTTCCAGCTCTTGAAGGTGG - Exonic
915440117 1:155940701-155940723 CCCTTTCCTGCTCTAGTCTGTGG - Intergenic
916288434 1:163136457-163136479 CCTTTGCCTACTTTTTAATGGGG + Intronic
916568296 1:166002312-166002334 CCTTTGCCTACTTTTTAATGAGG + Intergenic
916637288 1:166686373-166686395 CCTTTGCCTGCATTTTAATGGGG + Intergenic
916643286 1:166755604-166755626 CCTTTGCCTACTTTTTAATGGGG - Intergenic
916772878 1:167930248-167930270 TCTTTACCTGTTCTTTACTCTGG - Intronic
917181224 1:172300209-172300231 CCTTTGCCTACTTTTTAATGGGG + Intronic
917352081 1:174088733-174088755 CCTTTTCCCACTTTTTAATGGGG + Intergenic
917405596 1:174703906-174703928 CCTTTGCCCGCTTTTTAATGGGG + Intronic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
917544521 1:175949452-175949474 CCTCTTTCTGCTGTTTTCTGAGG - Intronic
917998365 1:180465330-180465352 CCTTTGCCTACTTTTTAATGGGG - Intronic
919245550 1:194978468-194978490 CCTTTGCCTACTTTTTAATGTGG + Intergenic
919399331 1:197090876-197090898 ATTTTTCCTGCTTTTTACGGAGG + Exonic
920624672 1:207585469-207585491 CCTTTTCCTACTCTTTTCTTTGG - Intronic
920954936 1:210610340-210610362 CCTTTCCCTACTTTTTAATGGGG + Intronic
921298884 1:213730591-213730613 CCTTTGCCCACTTTTTACTGGGG + Intergenic
921390704 1:214610512-214610534 CCTTTGCCTACTTTTTAATGGGG + Intronic
921462156 1:215442175-215442197 CCTTTGCCCACTTTTTACTGGGG + Intergenic
921955623 1:220980565-220980587 CCTTTTCCTCCTCTGTATTTTGG + Intergenic
922127239 1:222740014-222740036 CCTCTTCCTACTTCTTACTGAGG + Intronic
922430134 1:225543316-225543338 TATTATCCTGCTCTTTGCTGTGG - Intronic
924067022 1:240234303-240234325 CCTTTTTCTCCTCTTTTCAGGGG - Intronic
924294164 1:242568753-242568775 TCTTTTCCTGCTCTTAGGTGTGG + Intergenic
1062825641 10:566577-566599 CCTTTTCCTGCCCTCTCCAGAGG + Intronic
1062870906 10:903287-903309 CCTTTTCCTCCTCTGGACTCTGG - Intronic
1063133915 10:3200210-3200232 ACTTGCCCTGCTCATTACTGAGG + Intergenic
1064168949 10:13012355-13012377 CCTTTGCCCACTTTTTACTGGGG - Intronic
1065275117 10:24078014-24078036 CCTTTGCCTACTTTTTAATGGGG + Intronic
1065975430 10:30837617-30837639 CCTTTGCCCACTCTTTAATGGGG - Intronic
1066173686 10:32880374-32880396 CTTTTGCCTGCTTTTTAATGGGG + Intronic
1066239869 10:33523252-33523274 CCTTGTCCTGCTCTTTAATTAGG + Intergenic
1066667340 10:37797622-37797644 CCTTTGCCTGCTTTTTAATTGGG - Intronic
1067200819 10:44170473-44170495 CCATTTCATGCTCTTTTCTGGGG - Intergenic
1067235444 10:44443507-44443529 CCTTTTTCTGCTGTTTTCTCTGG - Intergenic
1067923761 10:50486482-50486504 CCTTTGCCTACTTTTTAATGGGG - Intronic
1068380758 10:56251115-56251137 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1069320865 10:67169940-67169962 CCTTTACCTGCTTTTTAATGGGG - Intronic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1071167168 10:82820368-82820390 CCTTTTCCTTCTCTTTATATTGG + Intronic
1071454174 10:85830632-85830654 CCTTTTCCCACTTTTTAATGGGG - Intronic
1071819206 10:89263690-89263712 CCTTTGCCTGAGCTTTACTCAGG + Intronic
1073126879 10:101156461-101156483 CTTTTTGCTGCTCTTGAGTGTGG + Intergenic
1073669472 10:105571429-105571451 CCTTTTCCCCCTTTTTAATGGGG - Intergenic
1073673820 10:105622469-105622491 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1073865179 10:107794808-107794830 CCTTTTCCTCCTCTATATTCTGG + Intergenic
1074248492 10:111718726-111718748 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1075783275 10:125031107-125031129 CCATTTCCTGCTTTTAAATGTGG + Intronic
1076198541 10:128539620-128539642 ACTTTTCTCGCTCTTGACTGTGG - Intergenic
1076210562 10:128640561-128640583 CATTTTCCTAATCTCTACTGAGG - Intergenic
1077835727 11:5925984-5926006 CCTTTGCCTACTTTTTAATGGGG - Intronic
1077911203 11:6572281-6572303 CCTTGCCCCGCTCTCTACTGTGG + Intronic
1077955108 11:7009741-7009763 CCTTTGCCTACTTTTTAATGGGG - Intronic
1078278150 11:9871310-9871332 CCTTTGCCTACTTTTTAATGGGG - Intronic
1079041845 11:17066603-17066625 CCTTTTCCTGAACTTTTCAGGGG - Intergenic
1079186338 11:18241031-18241053 CCTTTGCCCGCTTTTTAATGGGG - Intronic
1079276724 11:19045285-19045307 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1080144707 11:28967710-28967732 CCCTTTCCTGCTTTTTACTCTGG + Intergenic
1080150195 11:29043733-29043755 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1080293046 11:30692797-30692819 CCTTTACCTACTTTTTAATGAGG - Intergenic
1080403690 11:31959613-31959635 GGTTTTCCTGCTGTTTACTGAGG + Intronic
1080415553 11:32066841-32066863 GCTTCACCTGCTCTTTAATGTGG - Intronic
1080771632 11:35347392-35347414 CCTTTTTCTGGTCTTTAAAGTGG - Intronic
1080776767 11:35393892-35393914 CCTTTTCCTCTTCTTCCCTGTGG + Intronic
1081211397 11:40339040-40339062 CCTTTTCCTCCTCTTTATTAAGG + Intronic
1081425566 11:42922706-42922728 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1081720453 11:45285244-45285266 CCTTCTGCTGCTCTTTACAATGG + Intronic
1082681638 11:56180393-56180415 CCTTTTGCTGCTTTTTATTCAGG - Intergenic
1082772857 11:57222005-57222027 CCTTGCCCTCCTCCTTACTGGGG + Intergenic
1083129007 11:60604114-60604136 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1083138180 11:60699721-60699743 CCTATTCCTTTTCTTTGCTGTGG - Exonic
1083214991 11:61212898-61212920 CTTTTTCCTTCACATTACTGGGG + Exonic
1083217875 11:61231727-61231749 CTTTTTCCTTCACATTACTGGGG + Exonic
1083220865 11:61251477-61251499 CTTTTTCCTTCACATTACTGGGG + Intergenic
1083495571 11:63049345-63049367 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1083605919 11:63978842-63978864 CCTTTGCATCCTCTTTGCTGGGG + Intronic
1084872115 11:72105379-72105401 CCTCTGCCTGCTCTTCCCTGAGG - Intronic
1085151146 11:74253738-74253760 CCTTTCCCTTCCCTGTACTGGGG + Exonic
1085256369 11:75175895-75175917 CCATGTCCTGCTCTTCTCTGTGG - Intronic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1085852727 11:80140419-80140441 GGTTTTCCTCCTCTTTACAGAGG - Intergenic
1086031788 11:82368044-82368066 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1086231362 11:84574222-84574244 CCTTTCTCTTCTCTTTGCTGAGG - Intronic
1086788996 11:91010797-91010819 CCTTTTCCCACTTTTTATTGGGG - Intergenic
1087314078 11:96586032-96586054 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1087524253 11:99287992-99288014 CCTTATCCTCCTCTTCACTTTGG + Intronic
1087719594 11:101647350-101647372 CCTTTGCCCGCTTTTTAATGAGG - Intronic
1087867746 11:103252667-103252689 CCTTTGCCTGCTTTTTAATCAGG + Intronic
1088179907 11:107097658-107097680 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1088466560 11:110146362-110146384 TCTTTTCCTGCTCTGTCTTGTGG - Intronic
1089106444 11:116010212-116010234 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1089158018 11:116416955-116416977 CCTCCACCTGCTCTTAACTGTGG - Intergenic
1089174011 11:116535514-116535536 TCTTCTCCTGCTTTTTACAGAGG - Intergenic
1089336963 11:117731882-117731904 CTTTTTCTTTCTCTTTACTGTGG - Intronic
1092306975 12:7311269-7311291 CCCTCTCCTGCTCTCTACTGTGG + Intronic
1092758474 12:11787476-11787498 GTTTTTACTTCTCTTTACTGTGG + Intronic
1092853207 12:12649303-12649325 CCTGCTCCTGCTTTTTCCTGAGG - Intergenic
1092918480 12:13209320-13209342 CTTTCTCCTGGTCTTTCCTGAGG + Intronic
1093337682 12:17927278-17927300 TATTTTCATGGTCTTTACTGTGG + Intergenic
1093379944 12:18480022-18480044 CCTTGTTCTGCTCTCTTCTGTGG - Intronic
1093415737 12:18918455-18918477 CCTTTGCCTACTTTTTAATGCGG - Intergenic
1093978566 12:25450805-25450827 CCTTTTCCCACTTTTTAATGGGG - Intronic
1094055310 12:26263316-26263338 CCTTTTCCCACTTTTTAATGGGG - Intronic
1094434351 12:30404686-30404708 CCTTTGCCCACTTTTTACTGGGG + Intergenic
1095610611 12:44123222-44123244 CCTTTGCCTACTTTTTAATGGGG + Intronic
1095798955 12:46251655-46251677 CCTTTGCCCACTCTTTGCTGGGG - Intronic
1097136411 12:56860463-56860485 CTTTTGCCTGCTTTTTAATGGGG + Intergenic
1097207579 12:57335910-57335932 CCTTTTCCCACTTTTTAATGGGG - Intronic
1097794365 12:63845741-63845763 TTTTTTCCTCCTCTTTCCTGAGG + Intronic
1097916677 12:65027902-65027924 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1098140715 12:67447837-67447859 CCTTTTCCTTGTCTCTCCTGGGG - Intergenic
1098211824 12:68174444-68174466 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1099200820 12:79674726-79674748 CCTTTGCCCGCTTTTTAATGCGG - Intronic
1099429019 12:82558606-82558628 CCTTTTCCCCCTTTTTAATGAGG + Intergenic
1099435637 12:82641958-82641980 CCTTTTCCAACTTTTTAATGAGG - Intergenic
1099574815 12:84364907-84364929 CATTTTTTTGTTCTTTACTGGGG + Intergenic
1099795919 12:87399227-87399249 CCTTTTCCTACTTTTTGATGGGG - Intergenic
1100110736 12:91238852-91238874 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
1100279030 12:93100549-93100571 CTTTTTTCTGCTCTGTACTTTGG - Intergenic
1100671267 12:96815376-96815398 CCTTTGCCTACTCTTTGATGGGG + Intronic
1100808768 12:98316073-98316095 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1100911849 12:99373210-99373232 CCTATTCCTGCCCTTTCCTTGGG - Intronic
1101121109 12:101581079-101581101 CCTTTGCCTACTTTTTAATGGGG + Intronic
1101310078 12:103570052-103570074 CCTTTGCCTACTGTTTAATGAGG - Intergenic
1102034544 12:109763275-109763297 CCACTTCCTGCTCTGTACAGCGG + Intronic
1103031388 12:117616441-117616463 CCTATGCCTGCTCTTTTCTCTGG + Intronic
1103076879 12:117990535-117990557 CCTTTGCCCGCTTTTTAATGAGG - Intergenic
1104796390 12:131522457-131522479 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1104906232 12:132214839-132214861 CCTGTTCCTGCTCAGTTCTGTGG + Intronic
1105627370 13:22125898-22125920 CCCTTTGCTGCTCTTCACTGTGG + Intergenic
1105655299 13:22430091-22430113 CCTTTGCCCGCTTTTTAATGAGG + Intergenic
1105845056 13:24286809-24286831 CCTCGTCCTGCTCCTCACTGGGG - Exonic
1105943793 13:25172558-25172580 GCTTTTCCTGCTCTGTACATTGG - Intergenic
1106145103 13:27043319-27043341 GCTTTTCCTATTCTTTTCTGTGG - Intergenic
1106628089 13:31441631-31441653 CCTTTTCCTTGCCTCTACTGTGG + Intergenic
1106780783 13:33057082-33057104 CTTCCTCCTCCTCTTTACTGGGG + Intronic
1106890364 13:34238968-34238990 ACTTTTCCTGCTCTTTTCTGGGG - Intergenic
1107018731 13:35730478-35730500 GCTCTTCATGCTCTGTACTGTGG + Intergenic
1107543942 13:41419283-41419305 CCTTCCCCTCCTCCTTACTGTGG - Intergenic
1107549291 13:41459402-41459424 CCTTTTGCTGCCCTTGACTCAGG + Intronic
1108165134 13:47685147-47685169 CCTTTTCCCACTTTTTAATGGGG - Intergenic
1108501492 13:51073653-51073675 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1109145643 13:58776077-58776099 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1109284047 13:60391084-60391106 TCTTCTTCTGCTGTTTACTGCGG + Intergenic
1109291091 13:60475865-60475887 CCTTTGCCTATTCTTTAATGAGG + Intronic
1109606633 13:64705814-64705836 CCTTTTCCTTCTCTTAATTCTGG + Intergenic
1110049486 13:70876569-70876591 CCTTGTCTTGATCTTTACTCGGG - Intergenic
1110611862 13:77497516-77497538 TGTTTTCCTCCTCTCTACTGAGG + Intergenic
1111159599 13:84377167-84377189 GCTTTTCCTGCTTTGTACTCTGG + Intergenic
1111972495 13:94931378-94931400 CCTTCGCCAGCTTTTTACTGGGG + Intergenic
1112128454 13:96496103-96496125 ACAGTTCCTGCCCTTTACTGTGG - Intronic
1112409851 13:99153676-99153698 CTTTTTCCTGCTATTCAGTGTGG - Intergenic
1112854681 13:103753225-103753247 CCATTTGCTGCTCTCTACTAGGG + Intergenic
1113019410 13:105866673-105866695 CATTTTCCTGCTCCTCACAGAGG + Intergenic
1114560447 14:23586021-23586043 CCTTTGCCCACTTTTTACTGGGG + Intergenic
1114697989 14:24645208-24645230 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1114903072 14:27090050-27090072 CATATTCTTGCTCTTTACTGGGG - Intergenic
1115915356 14:38306460-38306482 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1116066638 14:39992589-39992611 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1116123591 14:40753117-40753139 CCTTTTCCTACTTTTTAATGGGG + Intergenic
1116280723 14:42903472-42903494 TTTTTTCCTGATCTTCACTGTGG + Intergenic
1116563554 14:46415550-46415572 CCTTCTCCTCCTCCTTTCTGAGG - Intergenic
1116766801 14:49082365-49082387 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1116777072 14:49193497-49193519 CCATTTCCTGCCCTTTCCTGAGG + Intergenic
1117660448 14:57998768-57998790 GCTTTTGCTGCTACTTACTGAGG + Intergenic
1117837331 14:59820215-59820237 CCTTTGCCTACTTTTTAATGGGG + Intronic
1118180765 14:63490553-63490575 CCTTTGCCCGCTTTTTAATGGGG - Intronic
1119333674 14:73814653-73814675 CCTTTTCCTGCTCATGCCTTTGG + Intergenic
1120368562 14:83603068-83603090 CCTTTTCCCACTTTTTAATGGGG + Intergenic
1120571132 14:86117595-86117617 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1121072367 14:91036114-91036136 CCTTTTCCTGTGCTTCACTGTGG - Intronic
1121644667 14:95509562-95509584 CTGTTTCCTGCTCTTTAAAGAGG - Intergenic
1121725344 14:96143964-96143986 CCTTTGCCCGCTTTTTAATGGGG - Intergenic
1121813593 14:96912635-96912657 CCTTTTCCAGCTCTTGAATCTGG - Intronic
1121865053 14:97355133-97355155 CCTTCTCCTCCTTTTTCCTGGGG + Intergenic
1122138529 14:99648381-99648403 CCTCTTACTGCTCTTAACCGTGG - Intronic
1122445759 14:101767425-101767447 CCTTGTCCTCCTCCTTACTCAGG - Intronic
1123101793 14:105808009-105808031 CTTTTTTCTGCTCTTTAGTTGGG + Intergenic
1123188381 14:106541798-106541820 CCTTTGCCAGGCCTTTACTGTGG - Intergenic
1123388002 15:19838679-19838701 CCTTTTCCTGCTATACATTGAGG + Intergenic
1123726078 15:23102494-23102516 ATATTTCCTGCTGTTTACTGGGG + Intergenic
1124359902 15:29028830-29028852 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1124841557 15:33246674-33246696 CTTTTACCTGCTCATTCCTGGGG - Intergenic
1125303044 15:38277934-38277956 CCTTTGCCTACTTTTTAATGGGG + Intronic
1125695579 15:41634593-41634615 CCCTTTCCTTCCCCTTACTGAGG + Intronic
1126046451 15:44645779-44645801 CCTTTTCCCACTTTTTAATGGGG - Intronic
1126236837 15:46395408-46395430 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1126431705 15:48592586-48592608 CCTTTGCCTTCTCTTTGCTTGGG - Intronic
1126659785 15:51021310-51021332 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1126755632 15:51922627-51922649 CCTTGTCCTACTATTTACTGAGG - Intronic
1126956804 15:53941727-53941749 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1127239638 15:57098473-57098495 CCTTTTTCTGCCTTTTACAGAGG + Intronic
1127973843 15:63983073-63983095 CCTTCTCCAGCCCTTTCCTGGGG - Intronic
1128383618 15:67131579-67131601 CAGTTTCCTCCTCTTTACAGCGG - Intronic
1128738245 15:70065814-70065836 CCTTTTCCTACTCCTTGGTGTGG - Intronic
1128797833 15:70478178-70478200 GCTTTTCCCACTCTTTCCTGTGG + Intergenic
1129333157 15:74838088-74838110 CCTTTCTCTGCTCTTACCTGTGG - Intronic
1129771564 15:78206378-78206400 CCTGTCCCTGCCCTTTACAGAGG + Intronic
1130102744 15:80906247-80906269 CCTCCTCTTGCTCTTTTCTGGGG - Intronic
1130165578 15:81454365-81454387 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1131520069 15:93107694-93107716 CCTTTGCCTCCTTTTTAATGGGG - Intergenic
1131665029 15:94561195-94561217 CCATTTAATGCTATTTACTGAGG + Intergenic
1131853967 15:96572428-96572450 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1132229433 15:100170863-100170885 CCTTCTCCTGCTATTGGCTGAGG - Intronic
1132297405 15:100750389-100750411 CCTTTGCCCCCTCTTTAATGGGG + Intergenic
1132923656 16:2415218-2415240 CTGTTTGCTGCTCTTTTCTGGGG - Intergenic
1132926097 16:2429729-2429751 CGTTTTCCGGCCCTTTCCTGGGG + Intronic
1133080711 16:3317297-3317319 TCTTTGCCTGCTGTTTTCTGGGG - Exonic
1133093178 16:3421221-3421243 CCTTTGCCTACTTTTTAATGGGG + Intronic
1134382928 16:13745113-13745135 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1134797132 16:17051126-17051148 CCTTTGCCTACTTTTTAATGTGG + Intergenic
1134912253 16:18038200-18038222 CCTTTTCCTCCTGTTTGCTAAGG + Intergenic
1135724121 16:24841368-24841390 CTTATTCTTGCTCTTTAGTGTGG - Intergenic
1137012984 16:35342658-35342680 ACTTTGCCTGCTTTTTAATGAGG - Intergenic
1137418491 16:48308972-48308994 CCTTTGCCTACTTTTTAATGGGG - Intronic
1138921703 16:61538225-61538247 CCTTTTCTTTCTTTTTAATGGGG - Intergenic
1139617562 16:68107889-68107911 CCTTTGCCTACTTTTTAATGGGG + Intronic
1141372888 16:83503713-83503735 CCTTCGCCTGCTTTTTAATGGGG + Intronic
1141554916 16:84830773-84830795 TTTTTTCCTGCATTTTACTGTGG + Intronic
1141867710 16:86762144-86762166 CCTTTTTCTGCTCTTCTATGGGG + Intergenic
1143821313 17:9566122-9566144 CCTTTGTCTGCTTTTTAATGGGG - Intronic
1145004047 17:19326943-19326965 CATTTCCCTGTTCTTTAATGAGG - Intronic
1145715249 17:27013465-27013487 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1146566735 17:33919840-33919862 CCTTTGCCCGCTTTTTAATGGGG - Intronic
1147877158 17:43629768-43629790 CCTTTCCCTTGCCTTTACTGGGG - Intergenic
1148671323 17:49412645-49412667 GCTTTTCTTCCACTTTACTGTGG - Intronic
1148723952 17:49775366-49775388 TCTATTCCTGGTTTTTACTGTGG + Intronic
1149021213 17:51967022-51967044 CTTTTGCCTGCTTTTTAATGGGG - Intronic
1149120357 17:53156070-53156092 CCTTTGCCTACTTTTTAATGAGG + Intergenic
1149247884 17:54732997-54733019 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1149379131 17:56075259-56075281 CATTTTCCTTCTCTGTACAGTGG + Intergenic
1149402615 17:56313443-56313465 CCTGTTCCTTCCCCTTACTGTGG - Intronic
1150168642 17:62967647-62967669 CCTTTTCCTGATTTTTACACAGG + Intergenic
1150246036 17:63676098-63676120 CCTTTTCCTGCTCCAGCCTGTGG + Intronic
1151049292 17:70958439-70958461 CCTTGGCCTGCTTTTTAATGGGG + Intergenic
1152685817 17:81693497-81693519 CCTTTCCCTCCGCTTTCCTGTGG - Exonic
1153454640 18:5266996-5267018 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1153493243 18:5671395-5671417 CCTTATCCTGCTCTGAACTGGGG + Intergenic
1153521738 18:5960571-5960593 CCTTCTCCTGCTCATCTCTGTGG + Intronic
1156536795 18:37872184-37872206 CCTCTTCCTGCTCCTTACATGGG - Intergenic
1156779359 18:40832657-40832679 TCTTTGCCTGCTTTTTAATGGGG - Intergenic
1156826739 18:41439000-41439022 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1157261133 18:46176350-46176372 CATTTTCCTGCACATAACTGAGG + Intronic
1157274349 18:46300091-46300113 CCTTTTTTTCCCCTTTACTGTGG - Intergenic
1157938554 18:51899849-51899871 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
1158112073 18:53951522-53951544 TCTTTTCCTGCTCTTGTCTGTGG + Intergenic
1159354585 18:67321387-67321409 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
1159606578 18:70480460-70480482 CCTTTTCCCACTTTTTAATGGGG + Intergenic
1159751852 18:72312534-72312556 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1159776779 18:72611566-72611588 CTTTTGCCTGCTTTTTAATGGGG + Intronic
1159905587 18:74088038-74088060 CCTTTGCCTACTTTTTAATGGGG + Intronic
1160117397 18:76093579-76093601 CCATTTCATTCTCTTTCCTGGGG - Intergenic
1160483569 18:79265513-79265535 CCTTTGCCTACTTTTTAGTGGGG + Intronic
1161158911 19:2750778-2750800 GCTTCTCCTCCTCTGTACTGTGG + Intergenic
1163654639 19:18538566-18538588 ACTTCCCCTGCACTTTACTGAGG - Intronic
1164439313 19:28260210-28260232 CCTTTGCCTACTTTTTATTGGGG - Intergenic
1164442132 19:28286882-28286904 CTTTTTCCTGCTGTTTCCCGGGG - Intergenic
1166176036 19:41070754-41070776 CCTTTTCCCACTTTTTAATGGGG + Intergenic
1167519317 19:49943862-49943884 CCTTTGCCTGCTTTTTAATGTGG - Intronic
1167815834 19:51880185-51880207 CTTTTTCCTGTTGTTTAGTGGGG - Intronic
925343662 2:3154352-3154374 CCTCTTCCTGCTTTTGACGGTGG + Intergenic
925698746 2:6611688-6611710 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
927622727 2:24678708-24678730 CATTTGCCTGCTTTTTAATGGGG + Intronic
928569431 2:32588530-32588552 CCATTTCCTGCATTTTATTGTGG + Intronic
930341811 2:50125877-50125899 CATTTTGCTGCACTTTCCTGTGG + Intronic
930478532 2:51916586-51916608 CCTTTGCCTACTCTTTAATGGGG - Intergenic
930725384 2:54676664-54676686 TCTTTTCCTGCACTTCTCTGTGG + Intergenic
930976400 2:57467186-57467208 CTTTTGCCTGCTTTTTAATGGGG + Intergenic
931202924 2:60117699-60117721 CCTTTGACTGCTTTTTAATGGGG + Intergenic
931229259 2:60360267-60360289 TCTTTGCCTGCTCTTCCCTGAGG + Intergenic
931454297 2:62395770-62395792 CCTTTGCCTACTTTTTAATGAGG - Intergenic
932273005 2:70427464-70427486 CATTTTCCTGCTAATTAATGAGG - Intergenic
932874502 2:75436309-75436331 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
932908305 2:75778529-75778551 CCTCTGCCTGCTTTTTAATGAGG - Intergenic
933101526 2:78264961-78264983 CCTTTGCCTACTTTTTAATGGGG - Intergenic
933159802 2:79011096-79011118 CCTTTTCTCTCTCCTTACTGGGG - Intergenic
933585952 2:84179545-84179567 CCGTTTCTTGATCTGTACTGTGG - Intergenic
933597877 2:84300946-84300968 CCTTTTCTGGCTGTTTGCTGGGG - Intergenic
935554987 2:104499526-104499548 CCTTCTTCTGATCTTTCCTGTGG + Intergenic
935846438 2:107170573-107170595 CCATTTTCTGCTGTATACTGTGG - Intergenic
935877588 2:107528038-107528060 CCTTTGCCCACTCTTTAATGGGG - Intergenic
936118730 2:109723593-109723615 CCTTTGCCTACTTTTTAATGGGG + Intergenic
936340232 2:111624771-111624793 CCTTTGCCTACTTTTTAATGGGG + Intergenic
936778542 2:116003610-116003632 CCTTTGCCTACTTTTTAATGGGG + Intergenic
937392130 2:121498160-121498182 TCTTTTCTTTCTTTTTACTGTGG + Intronic
937848365 2:126607285-126607307 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
938134553 2:128744349-128744371 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
938211657 2:129470653-129470675 CTTTTTCCTGCTGGTTTCTGAGG + Intergenic
939040705 2:137186056-137186078 CCTTTGCCTACTTTTTAGTGTGG + Intronic
939259417 2:139788210-139788232 CCTTCTCTTTCTCTTTCCTGGGG + Intergenic
939385787 2:141495351-141495373 CATTTTCCTGCTCATTACCATGG - Intronic
939484401 2:142792109-142792131 CCTATTCCTACTTTTTAATGGGG - Intergenic
939541141 2:143495221-143495243 CCTTTTCCTCTTCTTTATTTAGG + Intronic
939828714 2:147046917-147046939 CCTTTTTTTGTTCTTGACTGAGG - Intergenic
940120571 2:150260101-150260123 CCTACTCCAGCTCTTAACTGCGG + Intergenic
940383967 2:153048770-153048792 CTTTTGCCTGCTTTTTAATGGGG - Intergenic
940392897 2:153153222-153153244 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
941236228 2:162977838-162977860 CCTTTTCTTGTTTTTAACTGTGG - Intergenic
941597803 2:167499807-167499829 TATTTTGTTGCTCTTTACTGGGG - Intergenic
943155379 2:184168842-184168864 CCTTTACCTGTTCTTTAATGGGG - Intergenic
943177185 2:184491696-184491718 CCTTTCCCTACTTTTTAATGGGG - Intergenic
943444837 2:187971876-187971898 CCTTTGCCTGTTTTTTAATGGGG - Intergenic
943554578 2:189386641-189386663 CCTTTGCCTACTTTTTAATGGGG - Intergenic
943570137 2:189564492-189564514 AGTTTTCCTGCTGTTTACTTTGG - Intronic
944290003 2:197994233-197994255 CCTTCTCCTCATCTCTACTGAGG - Intronic
944299331 2:198104853-198104875 CCTTTGCCTGCTTTCTAATGGGG + Intronic
944471749 2:200060985-200061007 CCTTTGCCTACTTTTTAATGGGG - Intergenic
944627759 2:201589925-201589947 CCTTTGTCTGCTTTTTAATGGGG - Intronic
945224533 2:207519926-207519948 ACTTTTCTTATTCTTTACTGTGG + Intergenic
945463033 2:210133573-210133595 CCTTTTCCTTCTATTTGCTTTGG + Intronic
945882787 2:215343730-215343752 TCTTTTCATCCTCTTTAATGAGG + Intronic
946481761 2:220063774-220063796 CCTTGTTCTCCTCTTTACTTTGG - Intergenic
946936634 2:224728597-224728619 CTTTTTCCTTCTCTGTAGTGGGG - Intergenic
947137117 2:226986499-226986521 CCTTTACCTGCTTTTTGATGGGG - Intronic
947265601 2:228276293-228276315 CCTTTGCCTACTTTTTAATGGGG + Intergenic
947688237 2:232110021-232110043 CCTTTGCCTACTTTTTAATGGGG - Intronic
948305217 2:236941362-236941384 CCTTTTCCTTCTCCTTTATGGGG + Intergenic
1169407543 20:5335237-5335259 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1169481080 20:5981368-5981390 CCTGTTCCTGCTGTTCAATGTGG - Intronic
1169504769 20:6197704-6197726 CCTTTGCCTGTTGTTTACTCAGG + Intergenic
1169568534 20:6882008-6882030 CCATCTCCTGTTCTTCACTGAGG + Intergenic
1170234850 20:14091069-14091091 CCTTTGCCTGATTTTTAATGGGG + Intronic
1171514887 20:25721741-25721763 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1172571910 20:35977172-35977194 CCTCTTCCCGCCCTCTACTGCGG - Intronic
1173060385 20:39654745-39654767 TTTTATCCTGCTCTGTACTGTGG + Intergenic
1173243545 20:41318007-41318029 CCATATCCTGCTCTTTCCAGAGG + Intergenic
1173281208 20:41629672-41629694 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1173307832 20:41867335-41867357 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1175420965 20:58833255-58833277 TCTCTCCCTGCTCTTCACTGAGG - Intergenic
1176025532 20:62983431-62983453 GCTGTGCCTGCTCTTGACTGGGG + Intergenic
1176094869 20:63336035-63336057 CCTTTTCTGGCTCCTTCCTGAGG + Intergenic
1177564248 21:22797284-22797306 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1178196354 21:30348976-30348998 CCTTTTACTGAGCTTGACTGTGG + Intronic
1178197517 21:30364929-30364951 TCTTTTTCTCATCTTTACTGAGG - Intronic
1178243370 21:30928086-30928108 CCTTTGCCTACTTTTTAATGAGG - Intergenic
1178879924 21:36441313-36441335 CCTTTGCCCGCTTTTTAATGGGG - Intergenic
1178960955 21:37064467-37064489 CCTTATACTGCTCTTAAGTGTGG + Exonic
1179078614 21:38148671-38148693 CCTTTCCCTGCTCTTTACCTTGG + Intronic
1179138099 21:38698364-38698386 CCGTTTCCAGCTCTTTCCAGTGG + Intergenic
1179770043 21:43608268-43608290 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1180592328 22:16951411-16951433 CCTTTGCCTTCTTTTTAATGGGG - Intergenic
1182241349 22:28918762-28918784 CCTGTTCTTGCTCCCTACTGGGG + Intronic
1183964981 22:41436252-41436274 CCTTTCCTTTCTCTTTTCTGTGG + Exonic
1184171928 22:42765050-42765072 CCTCTTCCTGCCCTTTCCTGTGG - Intergenic
1184961450 22:47932165-47932187 CCTCTTTCTTCTCTCTACTGGGG - Intergenic
1185261849 22:49870647-49870669 CCTTTGCTTGCTTTTTAATGGGG + Intronic
949385659 3:3499489-3499511 GCTGTTCCTTCTCTTGACTGGGG - Intergenic
949421214 3:3868038-3868060 CCTTTGCCTGCTTTTTGATGGGG - Intronic
949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG + Intronic
950053282 3:10007918-10007940 CCTGGTCCTGTTCTTTATTGGGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950620840 3:14203962-14203984 CCTTTTCCTGCTCTTAGCCTTGG + Intergenic
950947758 3:16967589-16967611 CCTTTGCCTACTTTTTAATGGGG + Intronic
951849009 3:27117650-27117672 CCTTTGCCTACTTTTTAATGGGG + Intronic
951974528 3:28489987-28490009 CCTTTTCCCACTTTTTAATGGGG - Intronic
953135482 3:40178115-40178137 TCTTTCCCTGTTTTTTACTGTGG + Intronic
953549480 3:43890290-43890312 CCATTTCCTCCTCTCTACTTGGG - Intergenic
953587705 3:44219862-44219884 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
953602234 3:44378424-44378446 TCTTTGCCTGCTTTTTAATGGGG - Intronic
953892177 3:46759697-46759719 CGTTCTCCTTCTCTGTACTGTGG - Intronic
954486760 3:50860247-50860269 TCTTTTCTTCCTCTTTTCTGAGG + Intronic
954900788 3:54017675-54017697 CCGTTGCCTGCTTTTTAATGGGG - Intergenic
955075379 3:55608499-55608521 CCCTTTCCTTCTCTTTACAAAGG + Intronic
955138175 3:56241211-56241233 CCTTTTCCCACTCTTTAATGGGG - Intronic
955257938 3:57353697-57353719 CCTTTGCCTACTTTTTAATGGGG - Intronic
955303514 3:57807188-57807210 CCTTTGCCTGCTTTTTGATGGGG + Intronic
955674872 3:61437585-61437607 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
956267461 3:67413145-67413167 CCTTTTTCTGCCTTTAACTGGGG - Intronic
956386018 3:68720280-68720302 CCTTTGCCCGCTGTTTAATGAGG + Intergenic
956387907 3:68740516-68740538 CCTTTTCCTACTTTTTAATTAGG + Intronic
957126991 3:76174185-76174207 CCTTTGCCTGCTTTTTGATGGGG + Intronic
957696027 3:83638876-83638898 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
957763167 3:84586328-84586350 CCTTTGCCTACTTTTTAATGGGG + Intergenic
958821139 3:98975229-98975251 CCTTTGCCTGGTTTTTAATGGGG - Intergenic
958849840 3:99311486-99311508 CCTTTGCTTGCTTTTTAATGAGG - Intergenic
959029985 3:101288060-101288082 CCTTTGCCTACTTTTTAATGGGG - Intronic
959109294 3:102102350-102102372 ATTTTTCCTTCTTTTTACTGTGG + Intronic
959181313 3:102984159-102984181 CTTTTGCCTGCTCTTTAGTGGGG - Intergenic
959213047 3:103413521-103413543 CCTTTGCCCGCTATTTAATGGGG + Intergenic
959317451 3:104825332-104825354 CATTTTCTGGCTCTTTACTAAGG + Intergenic
959374378 3:105570453-105570475 CCTTTTCCTGTGCTCTGCTGTGG - Intronic
959960353 3:112291437-112291459 CCTTTGCCTACTTTTTAATGGGG - Intronic
960422199 3:117460695-117460717 CCTTTGCCCTCTTTTTACTGAGG - Intergenic
960455192 3:117862681-117862703 CTTTTTCCTGCCTCTTACTGAGG - Intergenic
960757711 3:121035041-121035063 CCTTTGCCTGTTTTTTAATGGGG + Intronic
960866931 3:122211403-122211425 CCTTTGCCTACTTTTTAATGGGG - Intronic
960944113 3:122954316-122954338 CCTGTTCCAGCCCTTTCCTGAGG + Intronic
961093997 3:124139202-124139224 CCTTTGCCTCCTCATTACTCTGG - Intronic
961407894 3:126695288-126695310 CCTTTGCCTACTTTTTAATGGGG + Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
961926051 3:130481869-130481891 CCTTTGCCTACTTTTTAATGGGG + Intronic
962081705 3:132146102-132146124 CCTTTCCCTGGTCTTTTCTCTGG + Intronic
962404417 3:135088229-135088251 CCCTTTCCAGCTATTTACTATGG - Intronic
962814579 3:138986968-138986990 CATTTTCCTGCCCTCTCCTGTGG - Intergenic
963193586 3:142501584-142501606 CCTTTGCCTACTTTTTAATGGGG - Intronic
963344767 3:144082065-144082087 CCTTTGCCTACTTTTTAATGGGG - Intergenic
963772993 3:149408480-149408502 GCTTTTTCTGCTCTTTTCTTGGG - Intergenic
964287500 3:155134958-155134980 TCTTTTCCTACTTTTTAATGGGG + Intronic
964366435 3:155955395-155955417 CCTTTGCCTGTTTTTTAATGGGG + Intergenic
964448602 3:156787236-156787258 GCTTATCCTGCTCTGTGCTGTGG + Intergenic
964458488 3:156895202-156895224 CCTTTGCCTACTTTTTAATGGGG - Intronic
964591381 3:158365972-158365994 CCTTTGCCTACTTTTTAATGGGG + Intronic
964762560 3:160148207-160148229 CCTTTGCCTACTTTTTAATGAGG + Intergenic
964937176 3:162104159-162104181 CCTTTGCCTACTTTTTAATGGGG + Intergenic
966212148 3:177464443-177464465 CCTTTTCCTGCTTTGTCCTCTGG + Intergenic
966356988 3:179091162-179091184 CCTTTGCCTACTTTTTAATGGGG - Intergenic
966488443 3:180498574-180498596 CCTTTGCCTACTTTTTAATGGGG + Intergenic
966681599 3:182647181-182647203 CCTTTTCCTACTCTATTCTTTGG - Intergenic
966908973 3:184547511-184547533 CCGTTTCCTTCTCTGTAATGGGG - Intronic
967211488 3:187174204-187174226 TCTTTTCCTGCTCACTGCTGTGG + Intronic
967264490 3:187678323-187678345 CCTTTTCCTTCTCTTGGCTTTGG - Intergenic
967478111 3:189943999-189944021 ATTTTTCCTGCTGTTTACAGTGG + Intergenic
967604042 3:191423216-191423238 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
967605466 3:191440241-191440263 CCTTTGCCTACTTTTTAATGTGG - Intergenic
967871762 3:194235717-194235739 CCTGTACCTGCTATTTAGTGAGG - Intergenic
967915328 3:194574114-194574136 CCATTTCCTTCTCTCTACAGTGG - Intergenic
968017772 3:195354504-195354526 CCTTTGCCTGCTTTTTAATGGGG + Intronic
968072258 3:195792299-195792321 CCTTTGCCTGCTTTTTGATGGGG - Intronic
968755375 4:2413188-2413210 TCATTTCCTGCGCTTTGCTGAGG - Intronic
969139095 4:5053285-5053307 GCTTTTCCTGATCTTTAGTCTGG + Intronic
969164237 4:5292465-5292487 CCTTTTCCCACTTTTTAATGGGG + Intronic
969404831 4:6984048-6984070 TCTTTTACAGGTCTTTACTGGGG + Intronic
969708378 4:8828098-8828120 CCTTTTCCTTCTCTTGACAGTGG - Intergenic
970103545 4:12554306-12554328 CTTTCTACTGCTCTTTACTGTGG + Intergenic
971413844 4:26404205-26404227 CCTTTGCCTACTTTTTAATGGGG + Intronic
972045953 4:34664471-34664493 CCTGGTCCTGGGCTTTACTGGGG + Intergenic
972813928 4:42622706-42622728 CCTTTTCCCACTTTTTAATGGGG - Intronic
973094828 4:46183474-46183496 CCTTTTCCCACTTTTTAATGAGG - Intergenic
973331391 4:48913306-48913328 CCTTTTCCTGCTCTATAGAAGGG + Intergenic
973584810 4:52379006-52379028 CCTTTTCATTCTCTTTTCTCTGG - Intergenic
973895555 4:55409244-55409266 AATTTTTCTGATCTTTACTGTGG + Intronic
974155585 4:58068032-58068054 CCTTTGCCCACTCTTTAATGGGG - Intergenic
974517813 4:62939637-62939659 CCTTTGCCTACTTTTTAGTGAGG + Intergenic
974907187 4:68072947-68072969 CCATTTCCTGGGCTTTCCTGAGG + Intronic
974954908 4:68626332-68626354 CCTATTCCTGCACATTACTGAGG + Intronic
975351300 4:73350361-73350383 CCTTTTCCTGCTACTCAGTGGGG + Intergenic
975441750 4:74419293-74419315 TCTTTTCTTTCTCTTTACAGAGG - Intergenic
975472218 4:74782921-74782943 CCTTTGCCTGTTTTTTAATGGGG + Intronic
975680474 4:76870427-76870449 CCTTTGCCTGCTTTTTAATGAGG - Intergenic
975889647 4:79012019-79012041 CCTTTGCCCACTCTTTAATGTGG - Intergenic
975894640 4:79074202-79074224 CCTTTGCCCACTCTTTAATGGGG - Intergenic
975932988 4:79549084-79549106 CCTTTTCCACCTTTTTACTTTGG - Intergenic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
976452954 4:85213001-85213023 CCTTTTCCCGCTTTTTAGTGGGG + Intergenic
976563353 4:86527003-86527025 CTTTTGCCTGCTTTTTAATGGGG - Intronic
977517533 4:98040146-98040168 CCTTTGCCCACTCTTTATTGGGG + Intronic
978112826 4:104983675-104983697 CCTTTGCCTACTTTTTAATGGGG - Intergenic
978567492 4:110099522-110099544 CCTTTTCCTGGTGATTACTCTGG - Intronic
978594055 4:110357549-110357571 CCTCTTCTAGCTCTTTACTCAGG - Intergenic
978608940 4:110515535-110515557 CCTTTTTAATCTCTTTACTGAGG + Intronic
978709785 4:111765818-111765840 CCTTTTCCCACTTTTTAATGGGG + Intergenic
980046937 4:127999613-127999635 CTTTTTCCTGTTTTTTAGTGAGG + Intronic
980118614 4:128705267-128705289 CCTTTGCCTACTTTTTAATGAGG + Intergenic
980500682 4:133648931-133648953 TCTTTACCTGCTTTTTAATGGGG + Intergenic
980531744 4:134065416-134065438 CCTTTGCCTGCTTTTTCATGAGG + Intergenic
980878717 4:138687802-138687824 CATTTTCCTGCTTGGTACTGAGG - Intergenic
981302169 4:143199805-143199827 CCTTTGCCTGCTTTTTAATAGGG + Intronic
981320558 4:143387000-143387022 TCTTATCATTCTCTTTACTGTGG - Intronic
981409089 4:144406801-144406823 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
981605950 4:146540565-146540587 CCTTTGCCCACTTTTTACTGAGG + Intergenic
981670150 4:147277347-147277369 CCTCTTCCTCATCATTACTGAGG - Intergenic
982120908 4:152142841-152142863 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
982181230 4:152750331-152750353 CCTTTGCCTGCTTTTTGATGGGG - Intronic
982971570 4:161994702-161994724 GCTTTTCCTACTTTTTAATGAGG + Intronic
982977902 4:162090406-162090428 CATTTTCCTGCTTTTTAATGGGG - Intronic
982984914 4:162195040-162195062 CTTTTTCCTACTTTTTAATGGGG - Intergenic
983054387 4:163084594-163084616 CCTTTTCCTGTTTTGTACTCTGG - Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
983673377 4:170264101-170264123 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
984028324 4:174571647-174571669 ACTTTTCATGTTCTTAACTGTGG + Intergenic
984140910 4:176002524-176002546 CGTTTTCCTCCCCTTCACTGTGG + Intronic
984261548 4:177449186-177449208 TCTTTGCCTACTCTTTAATGGGG + Intergenic
984591588 4:181623359-181623381 CCTGTTCCTCCACTTGACTGTGG - Intergenic
985526005 5:402115-402137 CCTTTTCCTGGTTTTTAATGGGG - Intronic
986381175 5:7187735-7187757 CCTTTGCCTACTTTTTAATGGGG + Intergenic
986678830 5:10215252-10215274 CCTTTCCTTGCTCTTGAATGAGG - Intergenic
987021512 5:13877621-13877643 ACTTTTCCTGCCCTTTGATGCGG - Intronic
987270115 5:16298993-16299015 CCTTTGCCTACTTTTTAATGGGG - Intergenic
987540265 5:19245903-19245925 CCTTTGCCCGCTCTTTGATGGGG - Intergenic
987925214 5:24331986-24332008 CCTTCTACTGTTCTTTAGTGAGG - Intergenic
988172729 5:27680706-27680728 CCTTTGCCTACTTTTTAATGGGG - Intergenic
988329305 5:29814830-29814852 ACTTTTCCTACACTTTTCTGTGG - Intergenic
988698873 5:33652452-33652474 CCTATTCCTACTTTTTAATGGGG + Intronic
988990119 5:36662342-36662364 CTTTTTGCTGCTATTTTCTGCGG + Intronic
989432086 5:41367466-41367488 CCTTTGCCAGCTTTTTAATGGGG + Intronic
990129951 5:52568734-52568756 CCTTTGCCTACTTTTTAATGGGG + Intergenic
990534865 5:56711250-56711272 CCTTTGCCTACTTTTTAATGGGG - Intergenic
991224051 5:64248422-64248444 CCTTTGCCTGCTTTTTGATGAGG - Intronic
991932992 5:71773685-71773707 CCTTTACCTACTTTTTAATGGGG - Intergenic
992213400 5:74502995-74503017 CCTTTTTCTTTTCTTCACTGTGG - Intergenic
992245911 5:74822238-74822260 CCTTTTCCTCATCTATACAGAGG - Intronic
992316489 5:75561328-75561350 CCTTTGCCTGCTTTTTGATGGGG + Intronic
992606321 5:78460570-78460592 CCTTTGCCTACTTTTTAATGGGG + Intronic
992640527 5:78764828-78764850 CCTTTTTGTCCTATTTACTGTGG - Intronic
993124750 5:83819757-83819779 CCTTTGCCTACTTTTTAATGGGG + Intergenic
993568654 5:89508045-89508067 CCTTTGCCTACTTTTTAATGTGG - Intergenic
993765455 5:91850980-91851002 CCTGATCCTGTTCTTCACTGTGG + Intergenic
994241527 5:97427226-97427248 CCTGTTTCAGCTTTTTACTGAGG + Intergenic
994855169 5:105111189-105111211 CATTTTCCTGCTCACTTCTGTGG - Intergenic
995272665 5:110239948-110239970 CCTTTTTCTGCTTTATCCTGTGG + Intergenic
995653469 5:114397856-114397878 CCTTTGCCTACTTTTTAATGGGG + Intronic
995858864 5:116620996-116621018 ATTTTTCCTGCTCTTTCCTTAGG - Intergenic
996000812 5:118361471-118361493 CCTTTGCCTACTTTTTAATGGGG - Intergenic
996106633 5:119512175-119512197 CTTTTTCCTTTTCTTCACTGTGG - Intronic
996642819 5:125777433-125777455 CCTTTTCCTGCTCGTGCCTTAGG - Intergenic
996788927 5:127271382-127271404 CCTTTGCCTACTTTTTAGTGGGG + Intergenic
997045025 5:130305575-130305597 CCTTTGCCTTCTTTTTAATGGGG - Intergenic
997193165 5:131959081-131959103 CTGTTTCCTCCTCTTTACAGAGG + Intronic
997886251 5:137632824-137632846 CCTTTGCCTGCTTTTTAATGGGG - Intronic
998175980 5:139902383-139902405 CCTCTTCCTGCTATTTGCTAAGG + Intronic
998919748 5:147055032-147055054 CCATTTCCTGTTTTTTTCTGGGG - Intronic
998962075 5:147498769-147498791 CCTTTGCCTACTTTTTAATGGGG + Intronic
999563701 5:152833850-152833872 CCTTTTACTGCTCTTTATTTGGG + Intergenic
999614588 5:153408703-153408725 CCTTTTCCTACTCTATTCTATGG - Intergenic
999628120 5:153541629-153541651 CCTTTTCTTGGTCTTAAATGAGG - Intronic
999779498 5:154837709-154837731 CGTTTTCCTGCACTTCACAGAGG - Intronic
999904927 5:156130309-156130331 CCTTTGCCTACTTTTTAATGGGG + Intronic
1000134397 5:158332185-158332207 CCTTTGCCTACTTTTTAGTGGGG + Intergenic
1000466833 5:161589436-161589458 CCTTTTCCTCCTTTTTGATGGGG + Intronic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1000530882 5:162418299-162418321 CCTTTGCCTGCTTTTTAATAGGG + Intergenic
1002660289 5:180787012-180787034 CCTTTTCCTGCTGTTCACCTTGG - Intergenic
1004057611 6:12156073-12156095 CCTTTGCCTGCTTTTTAATCGGG + Intronic
1004776704 6:18854645-18854667 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1004805374 6:19198444-19198466 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1004839280 6:19563925-19563947 CCTTTTCATGCTTTTTAATGGGG + Intergenic
1005682056 6:28217585-28217607 CCTTTTCTTTCTCTTTTCTGTGG + Intergenic
1005924187 6:30428231-30428253 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1006599754 6:35217580-35217602 CCTTCTCTTCCTCTTTAATGTGG + Intronic
1006624486 6:35387589-35387611 CCTCATCCTGCTCTTCACCGTGG + Intronic
1006657218 6:35606225-35606247 CCTTTGCCTACTTTTTAATGGGG - Intronic
1007318572 6:41009737-41009759 CCTTTTCTCCCTCTTGACTGGGG - Intergenic
1008288246 6:49680823-49680845 CCTTTTCCCACTTTTTAATGAGG + Intergenic
1008315548 6:50035505-50035527 CCTTTGCCTGATATTTAATGGGG - Intergenic
1009289006 6:61861039-61861061 CCTTTGCCTACTTTTTAATGAGG + Intronic
1010346102 6:74812794-74812816 CCTTGTCCTTCTTTTTAATGGGG - Intergenic
1010775742 6:79883152-79883174 CCTTTTCCCACTTTTTAATGGGG - Intergenic
1010957862 6:82111475-82111497 CCTTTGCCAGCTTTTTAATGGGG - Intergenic
1011063688 6:83300546-83300568 CCTTTGCCTACTTTTTAATGGGG - Intronic
1011136752 6:84108503-84108525 CCTTTGCCTACTTTTTAGTGGGG + Intergenic
1012253251 6:97003320-97003342 CCTTTTCCCACTTTTTAATGGGG + Intronic
1012520879 6:100119877-100119899 GGTTTTCCTGCCTTTTACTGTGG - Intergenic
1012770625 6:103429036-103429058 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1013695144 6:112693088-112693110 CTTTGTTCTGCTATTTACTGTGG + Intergenic
1013860252 6:114626895-114626917 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1014194020 6:118531677-118531699 CTTTTTCCTTCTTTTTAATGGGG - Intronic
1014900053 6:126952219-126952241 CCTTTTTCTTTTCTTTAATGTGG - Intergenic
1015377688 6:132529348-132529370 TCTTTTCCTTCTTTTTCCTGTGG - Intergenic
1016228792 6:141775892-141775914 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1016424063 6:143915530-143915552 CATTTTCCTGCCTTTTTCTGAGG - Intronic
1016624426 6:146149601-146149623 GGTTATCCAGCTCTTTACTGAGG + Intronic
1016678134 6:146795470-146795492 CCTTTTCCAACTTTTTAATGGGG - Intronic
1017204272 6:151788271-151788293 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1017731373 6:157319884-157319906 CAGTTTCCTGCCCTTTAATGGGG + Intronic
1018351102 6:162959925-162959947 CCTTTGCCCGCTTTTTAATGGGG - Intronic
1018395962 6:163378272-163378294 TCCCTTCCTGCTCTTTACCGTGG + Intergenic
1018510839 6:164522594-164522616 CCTTTGCCTACTTTTTAATGAGG + Intergenic
1018959373 6:168436549-168436571 CCTTTGCCCACTTTTTACTGGGG - Intergenic
1019997423 7:4733834-4733856 CCTTTCCCTGGTCTTTAGTCCGG + Intronic
1020359335 7:7310738-7310760 TCTTTTCCTCCTATTTTCTGGGG - Intergenic
1020491414 7:8788947-8788969 TCTTTACCTGCTTTTTAATGGGG + Intergenic
1020862731 7:13515371-13515393 CCTTTGCCCGCTTTTTAATGGGG - Intergenic
1020867506 7:13585872-13585894 CCTTTGTCTGCTTTTTAATGGGG + Intergenic
1020935709 7:14461133-14461155 ACCTTTCCTGCTCTTTCCTGTGG - Intronic
1021726595 7:23553068-23553090 CCTTTTTCTCTTCTTCACTGAGG - Intergenic
1022545252 7:31181393-31181415 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1022817102 7:33924269-33924291 CCTGTTACTGCTCTTGACTTTGG + Intronic
1022922639 7:35032104-35032126 TCTTTTCCTTCTTTTTCCTGGGG + Intronic
1023556454 7:41428320-41428342 CCTATTCCTTCTCTTTCCAGTGG + Intergenic
1024217629 7:47261256-47261278 CCTTTTCCCACTTTTTAATGGGG - Intergenic
1024680014 7:51676168-51676190 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
1024944325 7:54793534-54793556 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1026318027 7:69244434-69244456 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1027498849 7:78923015-78923037 CCTTTGCCTACTTTTTAATGGGG + Intronic
1027616499 7:80430825-80430847 CCTTTTCCTGGTGTTGGCTGTGG - Intronic
1027637939 7:80699704-80699726 CCTTTTCCCTTTCTTGACTGAGG + Intergenic
1027879308 7:83813056-83813078 CCTTTGCCCACTTTTTACTGAGG + Intergenic
1028881899 7:95889762-95889784 CCTTTGCCTACTTTTTAATGGGG - Intronic
1029011371 7:97265213-97265235 CATTTTCCTGCTTTTTAGGGAGG - Intergenic
1029364429 7:100107807-100107829 CCTCTTCCAGCTCTTGACTTGGG + Intronic
1030390794 7:108925866-108925888 CCTTTGCCTACTTTTTAGTGTGG + Intergenic
1030498951 7:110334938-110334960 CCTTTGCCTACTTTTTAATGAGG - Intergenic
1030614056 7:111719151-111719173 CCTTTGCCTACTTTTTAATGAGG + Intergenic
1030718235 7:112836308-112836330 CCTTTGCCTACTTTTTAATGGGG + Intronic
1030732549 7:113006990-113007012 CCTTTGCCCACTCTTTAATGAGG + Intergenic
1031052878 7:116962608-116962630 CCTTTGCCTACTTTTTAATGGGG + Intronic
1031089834 7:117340868-117340890 TGTTTTCATGCTCTATACTGGGG + Intergenic
1031093548 7:117391155-117391177 CCTTTGCCTACTTTTTAATGAGG + Intronic
1031167595 7:118248183-118248205 CCTTTGCCTACTTTTTAATGTGG + Intergenic
1031258279 7:119484004-119484026 CCTGTTCCTTCTTCTTACTGTGG - Intergenic
1031651710 7:124299522-124299544 CCTTTATCTGCTTTTTAATGAGG + Intergenic
1031744116 7:125471705-125471727 CCTTTGCCTGCTTTTTAATCAGG - Intergenic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1033565382 7:142573693-142573715 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1034216626 7:149412501-149412523 CCTTTGCCCGCTTTTTAATGGGG - Intergenic
1034409348 7:150931473-150931495 CCCTTTCCTCCTGTTCACTGTGG + Intergenic
1034804262 7:154075061-154075083 CATTTCCCTGATCATTACTGAGG - Intronic
1036210780 8:6839444-6839466 CCTTTTCCCCTTTTTTACTGAGG - Intergenic
1036954687 8:13174687-13174709 CCTTTGCCCACTTTTTACTGGGG + Intronic
1037137389 8:15479104-15479126 CCTTTGCCTGCTTTTTAATGGGG + Intronic
1037153918 8:15676297-15676319 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1037159115 8:15745623-15745645 CCTTTTTCTACTTTTTAATGGGG + Intronic
1037422164 8:18714450-18714472 CCTTTGCCTGCTTTTTGATGGGG - Intronic
1038956018 8:32469639-32469661 CCTTTTACTGATATTTACTGTGG - Intronic
1040858414 8:51973941-51973963 CATTTTCCTGCTCCTTCCGGTGG + Intergenic
1041343692 8:56872962-56872984 CCTTTGCCCTCTTTTTACTGGGG - Intergenic
1041523272 8:58777732-58777754 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1041602544 8:59737323-59737345 CCTTTGCCTCATTTTTACTGTGG - Intergenic
1041967146 8:63691767-63691789 CCTTTTCCAGCACCTTCCTGTGG + Intergenic
1042280007 8:67045603-67045625 CCTTTTCATGTTCTTACCTGAGG + Intronic
1042780586 8:72486806-72486828 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1043133943 8:76497922-76497944 CCTTTACCTGCTTTTTAATGAGG - Intergenic
1043666388 8:82820534-82820556 CTTTTTGCTGCATTTTACTGTGG + Intergenic
1043713800 8:83455585-83455607 ACTTTTCCTTCTCTGTAATGAGG - Intergenic
1043736359 8:83750404-83750426 CCTTTGCCTACTTTTTAATGAGG + Intergenic
1043817843 8:84825163-84825185 CCTTTGCCTTCTTTTTAATGGGG - Intronic
1043994518 8:86796567-86796589 CCTTTTCCCACTTTTTAATGAGG - Intergenic
1044033665 8:87270281-87270303 CCTTTGCCTACTTTTTAATGAGG - Intronic
1044039172 8:87343978-87344000 CTTTTTCATGCTCTTTGCTTAGG + Intronic
1045486442 8:102635219-102635241 CCTTTTGTTGGTTTTTACTGGGG - Intergenic
1045794665 8:106028614-106028636 CCTTTGCCTGCTTTTTGGTGGGG - Intergenic
1046350087 8:112998231-112998253 CCTTTTCCTTCTCATTACCCTGG + Intronic
1046449462 8:114369798-114369820 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1046523627 8:115357084-115357106 CCTCGTCCTGCTCTCTAGTGGGG - Intergenic
1046646959 8:116795699-116795721 CCTTTGCCTACTTTTTAATGGGG + Intronic
1047063362 8:121252483-121252505 CCTTTTTCTGCTCTTCCCTGGGG - Intergenic
1047540151 8:125756969-125756991 CCTTTGACTGCTTTTTAATGGGG + Intergenic
1047575208 8:126145715-126145737 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1047886645 8:129258237-129258259 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1048120406 8:131574611-131574633 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1048609065 8:136002111-136002133 GCTTTTCCTTCTCTTTACCTTGG - Intergenic
1048701599 8:137097205-137097227 CCTTTGCCCACTTTTTACTGGGG - Intergenic
1050342385 9:4653966-4653988 CCTTTGCCTACTTTTTAATGGGG - Intronic
1050403977 9:5287777-5287799 CCTTTGCCCACTTTTTACTGGGG + Intergenic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1051196750 9:14570285-14570307 ACCTTTCCTGCTTTTTTCTGTGG + Intergenic
1051551914 9:18339272-18339294 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1051615695 9:19004052-19004074 CCTTTGCCTGCTTTTTGATGGGG - Intronic
1051702989 9:19844342-19844364 CTTTTGCCTGCTTTTTAATGGGG + Intergenic
1051704110 9:19858670-19858692 CATTTGCCTGCTCTTTAATGGGG - Intergenic
1052176282 9:25466847-25466869 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1052285484 9:26780013-26780035 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1054770768 9:69081242-69081264 CCTTTGCCTACTTTTTAATGGGG - Intronic
1054789618 9:69243734-69243756 CATCTTCCTTCTCTTTTCTGTGG - Intronic
1055238951 9:74160373-74160395 CCTTTTTGTGCTCTTTCCTGAGG - Intergenic
1055362016 9:75501829-75501851 CCTTTGCCTGATTTTTAATGGGG + Intergenic
1055428325 9:76218218-76218240 GCTTTTCCTGCACTGTGCTGTGG - Intronic
1055841822 9:80514275-80514297 CCTTTTCCCACTTTTTAATGGGG + Intergenic
1056085350 9:83143393-83143415 CCTTTTCCTGTTTTTTAATGGGG - Intergenic
1056252155 9:84760734-84760756 CCCTTTCCACCTCTTTACTTTGG - Intronic
1056376973 9:86024317-86024339 CCTTTTCCTGCTCTATACTTCGG - Intergenic
1056894884 9:90535956-90535978 TCTTTTGCTGAACTTTACTGGGG + Intergenic
1056906964 9:90660371-90660393 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1056929919 9:90865856-90865878 TATTTTCCTGCTCTTTTCTTGGG + Intronic
1057360370 9:94367982-94368004 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1057581847 9:96294112-96294134 CCTCTTTATGTTCTTTACTGAGG - Intronic
1057662972 9:97020095-97020117 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1058016212 9:100035392-100035414 CCTTTGCCTACTTTTTAATGGGG - Intronic
1058130444 9:101246779-101246801 CGTTTTCCTGTTCTTGTCTGGGG + Intronic
1059022754 9:110594347-110594369 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1059641573 9:116221876-116221898 CCTTTTCCTGATGATTAGTGAGG - Intronic
1059855487 9:118392776-118392798 CCTTGTGCTGCCCTTTATTGTGG + Intergenic
1061627925 9:131852470-131852492 CCTTTTCCTCCTCCTCACAGAGG - Intergenic
1061753081 9:132794165-132794187 CCCTTTTCTGCTCTTTCCTAGGG - Intronic
1062387804 9:136320620-136320642 CCTTTGCCTACTTTTTAATGAGG + Intergenic
1062708927 9:137961030-137961052 CCTTTGCCTACTTTTTAATGGGG + Intronic
1185489239 X:508232-508254 CCTTTTGCTTCTCTTTACCTAGG + Intergenic
1185954037 X:4469462-4469484 CCTCTTCCTTATCTTTACTCAGG + Intergenic
1186051344 X:5599026-5599048 TCTTTGCCTACTCTTTAATGGGG + Intergenic
1186134855 X:6508345-6508367 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1186672472 X:11781415-11781437 CTTTTTCATGCTTTTTGCTGTGG - Intergenic
1187382328 X:18814663-18814685 CCTTTGCCCGCTTTTTAATGGGG + Intronic
1187560012 X:20393501-20393523 CCTTTGCCTGCTTTTTAACGAGG + Intergenic
1187926624 X:24256538-24256560 CCTATTTCTACTTTTTACTGAGG + Intergenic
1188268090 X:28103312-28103334 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1188441822 X:30221015-30221037 CCGTTTTCTTCTCATTACTGCGG + Intergenic
1188648911 X:32605712-32605734 CCTTTGCCTACTTTTTAATGGGG - Intronic
1188725062 X:33572722-33572744 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1189611181 X:42737699-42737721 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1189672767 X:43428644-43428666 CCTTTGCCCGCTTTTTAATGAGG + Intergenic
1190133261 X:47770344-47770366 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1190486217 X:50927506-50927528 CCTGTTGCTGGGCTTTACTGTGG + Intergenic
1190902685 X:54693822-54693844 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1190960930 X:55246725-55246747 CCTTTGCCTACTTTTTAATGGGG - Intronic
1191216989 X:57942972-57942994 CCTTTTCCCACTTTTTAGTGAGG + Intergenic
1191977312 X:66887612-66887634 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
1192311485 X:70019011-70019033 CCTTTGCCCACTCTTTAATGGGG - Intronic
1192508535 X:71707162-71707184 CCTTTCCTTGCTCTTCTCTGTGG + Intergenic
1192512112 X:71727554-71727576 CCTTTCCTTGCTCTTCTCTGTGG - Intergenic
1192514585 X:71753951-71753973 CCTTTCCTTGCTCTTCTCTGTGG + Intergenic
1192518162 X:71774391-71774413 CCTTTCCTTGCTCTTCTCTGTGG - Intergenic
1192526986 X:71855380-71855402 CCTTTGCCCGCTTTTTAATGGGG + Intergenic
1192892377 X:75404546-75404568 CCTTTGCCTACTTTTTAATGGGG - Intronic
1192980938 X:76340668-76340690 CCTTTTCCTACTTTTTGATGGGG - Intergenic
1193094602 X:77532958-77532980 CCTTTGCCTACTTTTTAATGGGG - Intronic
1193160777 X:78226758-78226780 CCTTTGCCTGCTTTTTGATGAGG + Intergenic
1193625568 X:83816117-83816139 CCTTTCCCTGCTTTTTAATGGGG + Intergenic
1193777413 X:85660223-85660245 CCTTTGCCTACTTTTTAATGAGG - Intergenic
1193849415 X:86517717-86517739 CCTTTGCCCGCTTTTTAATGGGG + Intronic
1193858719 X:86638576-86638598 CCTTTACCTGCTTGTTAATGGGG - Intronic
1194039993 X:88928992-88929014 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1194134104 X:90117487-90117509 CCTTTGCCTCCTTTTTAATGTGG - Intergenic
1194901589 X:99519043-99519065 CCTTTTCCCACTTTTTAATGGGG - Intergenic
1195066409 X:101242120-101242142 TCTTTTCCTGGTGTTTTCTGAGG + Intronic
1195507436 X:105673991-105674013 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1195526625 X:105898395-105898417 GCTTTTCCTGCTATTTATTTTGG - Intronic
1196000430 X:110778423-110778445 CCTTTATCTGCTTTTTAATGAGG - Intronic
1196216865 X:113063076-113063098 CCTTTGCCTACTTTTTATTGGGG + Intergenic
1196400391 X:115310544-115310566 CCTTTACCTGCTTTTTAATTGGG + Intergenic
1196950767 X:120874547-120874569 TCTTTTCCTTCTGTTTCCTGCGG + Intronic
1196982077 X:121225798-121225820 CCCTTGCCTACTCTTTAATGAGG + Intergenic
1197037606 X:121895355-121895377 CTTTTTCCTGCTTTTTATTCTGG - Intergenic
1197952566 X:131913596-131913618 CCTTTTCCCACTTTTTAATGGGG + Intergenic
1197984388 X:132252265-132252287 CCTTTGCCTACTTTTTAGTGGGG - Intergenic
1198168042 X:134077067-134077089 CCTTTTTCTACTTTTTACTCAGG + Intergenic
1198303349 X:135353292-135353314 CCTTTTCCTTCACTTAAGTGTGG - Intronic
1198769561 X:140115045-140115067 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1198957988 X:142152771-142152793 CCTTTGCCTGATTTTTAATGGGG + Intergenic
1199056284 X:143298893-143298915 TCTACTCCTGCTCTCTACTGTGG - Intergenic
1199068266 X:143445755-143445777 CCTTTGCCTACTTTTTAATGGGG + Intergenic
1199165532 X:144670455-144670477 CCTTTTCCTGATCCTCACTCTGG - Intergenic
1199311144 X:146321018-146321040 CCTTTGCCTACTTTTTAATGAGG - Intergenic
1199597715 X:149521014-149521036 CCTTTGCCTGGTTTTTAATGGGG - Intronic
1200479885 Y:3687602-3687624 CCTTTGCCTCCTTTTTAATGTGG - Intergenic
1200483419 Y:3736420-3736442 CCTTTGCCTACTTTTTAATGGGG - Intergenic
1200742673 Y:6871065-6871087 CCTTTTCCTGCTCTCTAAGATGG - Intronic
1200845482 Y:7828285-7828307 CCTTTACCAGATTTTTACTGGGG + Intergenic
1201618113 Y:15924260-15924282 CCTTTTCCTACTTTTTAATGGGG + Intergenic
1201666183 Y:16458617-16458639 CTTTTTCCTGGGCATTACTGCGG + Intergenic