ID: 1033011165

View in Genome Browser
Species Human (GRCh38)
Location 7:137624512-137624534
Sequence GGGCGCTGAAAAATGCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033011165 Original CRISPR GGGCGCTGAAAAATGCCATT GGG (reversed) Intronic
902782169 1:18711861-18711883 AGACACTGAAAAATGTCATTCGG - Intronic
904352869 1:29920345-29920367 TGGGGCTGAAAAGTGCCAGTTGG - Intergenic
904872042 1:33625061-33625083 GGGCGCTGAGACATTCCATTGGG + Exonic
905102458 1:35536717-35536739 TGGCTGTGAAAAATGCCTTTGGG - Intronic
907532984 1:55120446-55120468 GGGTCCTGAAAGATGGCATTTGG - Intronic
909945213 1:81655910-81655932 GGGCTCTGAAAACAGTCATTAGG - Intronic
911853158 1:102843601-102843623 TGTGGCTGAAAAATGCAATTGGG + Intergenic
915385033 1:155483428-155483450 GGGCTTTGAAAAATGATATTTGG - Intronic
916003079 1:160634983-160635005 GGGGGAGGGAAAATGCCATTAGG - Intronic
917370202 1:174284852-174284874 GGATTGTGAAAAATGCCATTGGG + Intronic
918477436 1:184940163-184940185 GTGCCCTGAAAAAGGACATTGGG + Intronic
920823349 1:209401854-209401876 GGTGGCTGAAAAGTGCCATGGGG + Intergenic
920898669 1:210084062-210084084 TGGCGCTAAAAAATATCATTGGG - Intronic
924081716 1:240405922-240405944 GGCCTCTGAGAAATGCCTTTGGG - Intronic
1063335511 10:5209814-5209836 GGGAGCTAAAAGATGACATTTGG + Intronic
1064437275 10:15322145-15322167 GGCTGCAGAAAAATACCATTGGG + Intronic
1068533442 10:58213852-58213874 AGGTAATGAAAAATGCCATTTGG + Intronic
1069845181 10:71365932-71365954 GTGCCCTAAAAACTGCCATTTGG - Intergenic
1072219769 10:93317335-93317357 GGCCTTTGAAAAATACCATTGGG + Intronic
1075081007 10:119383918-119383940 GAGCTTTGAAAAATGCCAATAGG - Intronic
1079838389 11:25364570-25364592 GGGAGCTGCAAAATGAGATTTGG + Intergenic
1080746121 11:35110218-35110240 GGCAGCTCAAAAATGCCATCAGG + Intergenic
1080903839 11:36521258-36521280 GGGAGCTGAAAGATGAGATTTGG - Intronic
1081875981 11:46408649-46408671 TGGGGCTGATGAATGCCATTGGG - Exonic
1083741797 11:64715169-64715191 GGGCTCTGACAAATGCTGTTTGG - Intronic
1087207089 11:95408351-95408373 AGGCCCTGAATGATGCCATTGGG + Intergenic
1090153242 11:124407539-124407561 TGGCACAGAAAAATGACATTAGG - Intergenic
1090962998 11:131573687-131573709 GGGAGCAGAAAAATGTCATCTGG - Intronic
1092409622 12:8243352-8243374 GGGCGGGGATAAACGCCATTGGG + Intergenic
1093077236 12:14770723-14770745 GGGCCCTGAAAAGGGCCTTTTGG + Exonic
1096832411 12:54324720-54324742 GGGCGCTGAAAATAGGGATTAGG + Intronic
1099457750 12:82884798-82884820 TGGAACTGAAAAATGACATTAGG - Intronic
1102573198 12:113840218-113840240 GAGTGCTGAAAAATGCAATGAGG + Intronic
1104294866 12:127502611-127502633 GGGAGCTGGAAAATCTCATTCGG - Intergenic
1104834007 12:131775393-131775415 AGGGGCTGAAAGACGCCATTGGG - Intronic
1104872817 12:132012752-132012774 AGGCGCTGACAATTACCATTTGG - Intronic
1107265848 13:38553477-38553499 TGGAGCTGAAAAATGCAACTGGG - Intergenic
1107360950 13:39617356-39617378 TGGAGCTGAAAAAGGACATTAGG + Intergenic
1108329464 13:49370805-49370827 GGGTGATTAAAAATGGCATTTGG - Intronic
1109599276 13:64601823-64601845 GGGGGCTGAAATATGCGAATGGG + Intergenic
1115055925 14:29126332-29126354 GGGTGCTGTGAAAAGCCATTTGG + Intergenic
1116997256 14:51336662-51336684 GAGAGCTGGAAAATGCCATTAGG + Intergenic
1119203462 14:72776579-72776601 GGGCTCTGAAAAATCACATTTGG - Intronic
1122259059 14:100501831-100501853 GGGGGCTCACAAAGGCCATTTGG + Intronic
1123874047 15:24606131-24606153 GGGAGGTCAAAAAGGCCATTAGG + Intergenic
1132025729 15:98403081-98403103 GGGCCCTTAAAAATGTGATTAGG - Intergenic
1141865394 16:86746633-86746655 GGGTGCGGAAATAAGCCATTGGG + Intergenic
1144104494 17:11973048-11973070 GGGCGCGGAAATAAGGCATTGGG - Intergenic
1144940272 17:18934225-18934247 AGCTGCTAAAAAATGCCATTGGG - Intergenic
1152142717 17:78547264-78547286 GGGCTTGGAAAAATACCATTTGG - Intronic
1152857024 17:82670834-82670856 GGGCGCTTAAAAAGACCATCAGG - Intronic
1153963801 18:10162027-10162049 TGGGGCTGTAAAATGCCATATGG - Intergenic
1159546585 18:69846400-69846422 GGGAGCTGAGAAATGCCATATGG + Exonic
1163683144 19:18695327-18695349 GGACTCTGTAAAATGCCATATGG + Intronic
1164572381 19:29383783-29383805 AGGTGCTTAAAGATGCCATTGGG + Intergenic
1165633623 19:37322280-37322302 GGGAGCGTAAAAAGGCCATTTGG - Intronic
1166499120 19:43328125-43328147 GGGCGCGGAAATAAGCAATTGGG + Intergenic
1166529667 19:43534871-43534893 GGGAGCAGAAACATGCAATTTGG + Intronic
928803063 2:35117013-35117035 TGGAGCTGAAAAATGCAATTAGG + Intergenic
928884706 2:36135024-36135046 TGGCACAGAAAAATGACATTAGG - Intergenic
931483197 2:62664046-62664068 AGGCCCTGGAAAATGTCATTGGG + Intergenic
937512654 2:122613092-122613114 TGGAGCTGAAAAATTCCAATTGG + Intergenic
937588776 2:123589142-123589164 TGGAGCTGATAAATGCCCTTAGG + Intergenic
938920323 2:135988713-135988735 GGGAGCTGGAAAATGACTTTTGG + Intergenic
946692937 2:222322752-222322774 GGACTCTTAAAAATGCCATGTGG + Intergenic
1170485711 20:16813780-16813802 GGGTTCTGAAAAATTCCATAAGG + Intergenic
1182732094 22:32503865-32503887 GGGCGCGGAAATAAGCAATTGGG - Intergenic
1183628024 22:39016599-39016621 GGGCGCTAAACAAGGCCTTTTGG - Intronic
1183630544 22:39029995-39030017 GGGCGCTAAACAAGGCCTTTTGG - Intronic
1183634000 22:39050087-39050109 GGGCGCTAAACAAGGCCTTTTGG - Intronic
949833011 3:8236569-8236591 GGGAGCAGAAAAAGGACATTAGG + Intergenic
954926117 3:54236249-54236271 TGGAGCAGAAAAATGACATTAGG + Intronic
956763223 3:72461896-72461918 GAGGGCTGAAAAATGCCCTTTGG + Intergenic
960232777 3:115247815-115247837 GGGCTCTGAAAAATCCCTTAAGG + Intergenic
961888530 3:130111879-130111901 GGGCGGGGATAAACGCCATTGGG + Intronic
963274605 3:143317509-143317531 GGGGGCTGAAAGATGAGATTTGG + Intronic
966628586 3:182046972-182046994 GGGCAGTTTAAAATGCCATTTGG + Intergenic
967852320 3:194091446-194091468 GGGAGGTGAAAAATGATATTAGG - Intergenic
969148145 4:5142101-5142123 GGGCACAGAAAAGTGCCCTTGGG + Intronic
969756330 4:9152866-9152888 GGGCGGGGATAAACGCCATTGGG - Intergenic
972701567 4:41499094-41499116 GGGCAGTGCAAAATGCTATTTGG + Intronic
979524222 4:121700416-121700438 GGACACTGATAAAGGCCATTGGG - Intergenic
979594901 4:122524399-122524421 TGGAGCTGAGAAATGCAATTGGG - Intergenic
982758959 4:159257519-159257541 GGGAGCTGTAAAATGAGATTTGG + Intronic
986254417 5:6090193-6090215 GGGAACTGAAAAAGGCCAGTGGG + Intergenic
987640936 5:20611638-20611660 TGGGGCTGAAACATGCAATTGGG + Intergenic
1002574901 5:180168979-180169001 GGGCTTTGAAAACTGGCATTTGG - Intronic
1002895117 6:1374495-1374517 AGGCCCTAAGAAATGCCATTGGG - Intergenic
1002898838 6:1394018-1394040 GGGCGCAGAGAAATGCCCTTTGG - Intronic
1005466931 6:26124663-26124685 GGGCTCTGAAAAGAGCCTTTGGG - Exonic
1005649283 6:27871849-27871871 GGGCTCTGAAAAGAGCCTTTTGG + Intergenic
1006512774 6:34530527-34530549 TGGCGCTGACCAATGCCACTGGG + Exonic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1010009312 6:71031643-71031665 GGGCTATGAAAAATGCCTCTGGG + Intergenic
1012147571 6:95704572-95704594 TGACGTTGAAAAATGCGATTTGG - Intergenic
1014243761 6:119045460-119045482 GGCCTCTGAAAAATGCATTTTGG + Intronic
1015410516 6:132888787-132888809 AGGAGCTGAAAAATGGCAATAGG - Intergenic
1015517244 6:134095258-134095280 GGTTGCCAAAAAATGCCATTTGG - Intergenic
1015667312 6:135646473-135646495 GGGCTCTGAAAAACTCCAATAGG - Intergenic
1024987196 7:55205531-55205553 GAGCCCTTAAAGATGCCATTTGG - Exonic
1025812161 7:64882261-64882283 GGGCGCTGAAAGCTGCTCTTGGG - Intronic
1033011165 7:137624512-137624534 GGGCGCTGAAAAATGCCATTGGG - Intronic
1033308292 7:140240604-140240626 GGGAGCTGAAAACAGCCCTTAGG + Intergenic
1034851364 7:154497092-154497114 GAGCTCTGAAAAATACCACTGGG - Intronic
1036003670 8:4637507-4637529 GGGCTCTCAATAGTGCCATTGGG + Exonic
1036379571 8:8228174-8228196 GGGCGGGGATAAACGCCATTGGG - Intergenic
1041312195 8:56528340-56528362 GGACCCTGAAAAATACCACTAGG - Intergenic
1046112638 8:109744595-109744617 GGGAGCTGAAACATGAAATTTGG + Intergenic
1046927181 8:119804405-119804427 GGGCGCTGCAAGATGAGATTTGG - Intronic
1047572746 8:126118198-126118220 TGCCTGTGAAAAATGCCATTGGG - Intergenic
1050419134 9:5444674-5444696 GGAGGCTGAGAAATGCCATCAGG - Intergenic
1055052094 9:71991230-71991252 GAGACCTGAAAAATGCCAGTGGG + Intergenic
1058505622 9:105662971-105662993 GGGAGCTGAAAGAAGCCATGAGG + Exonic
1060875893 9:127083372-127083394 GTGAACTGAAAAATGCCATCTGG + Intronic
1189279452 X:39810955-39810977 GGGAGCTGAAAAGTGTGATTTGG + Intergenic
1194733924 X:97488970-97488992 TTTCTCTGAAAAATGCCATTGGG + Intronic
1196940528 X:120771480-120771502 GGGGGCAGAGAAATGCCATCTGG - Intergenic
1198190635 X:134300766-134300788 TGGAGCTGAAAAATGAAATTGGG + Intergenic
1201552932 Y:15237688-15237710 AGGCGCTGAAATATGTAATTAGG - Intergenic