ID: 1033011320

View in Genome Browser
Species Human (GRCh38)
Location 7:137625605-137625627
Sequence CTGTTTGCACAGACTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033011314_1033011320 18 Left 1033011314 7:137625564-137625586 CCAATTGACAGCACAGTTAAGAG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG 0: 1
1: 0
2: 1
3: 25
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033011320 Original CRISPR CTGTTTGCACAGACTGGGCA TGG Intronic
900391404 1:2435531-2435553 CTCTTTGCAGGGACTGGGGAAGG + Intronic
901328825 1:8388612-8388634 AAGATTGCACAGACTGGGCCGGG - Intronic
903972962 1:27131039-27131061 CTGGCTGCTGAGACTGGGCAGGG + Intronic
904331568 1:29761319-29761341 CAGCTTGCTCAGAGTGGGCAGGG + Intergenic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
905664364 1:39753581-39753603 CTTTTTGCACAGCCTGCCCATGG - Intronic
906112970 1:43336927-43336949 CTGTTTGCTCAGATTGGAGATGG - Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906535355 1:46548282-46548304 CTGGTGGCAGAGACTGGGCTGGG + Intronic
906700960 1:47857648-47857670 CTCTGTGCCCAGCCTGGGCAGGG - Intronic
907413547 1:54298789-54298811 CTGTTTGCACACGCTGACCATGG - Intronic
912958011 1:114169589-114169611 CTGTTTGCACACACTTGACATGG - Intergenic
913666757 1:121056083-121056105 CTGAATGGACAGGCTGGGCATGG - Intergenic
914018501 1:143843519-143843541 CTGAATGGACAGGCTGGGCATGG - Intergenic
914322363 1:146577480-146577502 CTGTATTCAGAGACTTGGCATGG + Intergenic
914657056 1:149751722-149751744 CTGAATGGACAGGCTGGGCATGG - Intergenic
914814988 1:151056732-151056754 CTGTTTGCACATGCGTGGCATGG + Intronic
915106751 1:153539649-153539671 CTGTGTGCACAGCATGGCCAGGG - Intronic
915449953 1:155997877-155997899 CTGGGTGCCCAGGCTGGGCATGG - Intronic
915519617 1:156434303-156434325 CTGTATGCACAGACTATGCTGGG - Intergenic
916695964 1:167236727-167236749 ATGGTTGCAGAGTCTGGGCAGGG + Intronic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
918546802 1:185693839-185693861 ATTTTTGCACAGGCTGGGCTGGG + Intergenic
919612347 1:199760635-199760657 TTGTTTGTAGAGGCTGGGCATGG - Intergenic
919857690 1:201716980-201717002 CTGATTGCCCTGACTGGCCAGGG + Intronic
921370559 1:214418535-214418557 TGGTTTGCCCAGAATGGGCAGGG - Intronic
922406402 1:225318192-225318214 CTGCTTGCACAGCCTTGGAAGGG + Intronic
922678449 1:227568783-227568805 CAGTTTGCACAGACCTTGCAAGG - Intronic
923059557 1:230458136-230458158 CTGTTTTCTGAGGCTGGGCACGG - Intergenic
924803947 1:247347924-247347946 CTGCTTGCACTTACTGGGGATGG - Intergenic
1062801991 10:387675-387697 CTGTGTGGACAGGCAGGGCAGGG + Intronic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1063937739 10:11096606-11096628 TTGTATGGCCAGACTGGGCATGG + Intronic
1064360395 10:14659148-14659170 CTGTCTGCCCTGGCTGGGCACGG + Intronic
1066462066 10:35620877-35620899 ATGTCTGCACAGGCTGGGCGTGG - Intergenic
1070057882 10:72953047-72953069 CTGTTTGCACGGATGGGACAGGG - Intronic
1070728378 10:78808000-78808022 ATCTCTGCACAGGCTGGGCAGGG - Intergenic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1071829406 10:89356783-89356805 GTTTTTCCACAGACTGGGCAGGG - Intronic
1075421120 10:122301437-122301459 CTGTCTGCACAGACAGTCCAGGG + Intronic
1078743799 11:14091945-14091967 CTGCTTGCACTTCCTGGGCAAGG + Intronic
1078812690 11:14784127-14784149 ATTTTTCCACAGACTGGGTAGGG - Intronic
1079381361 11:19940759-19940781 CTGGTTCCACTGCCTGGGCACGG + Intronic
1080763363 11:35273739-35273761 CTTATGGCACAGGCTGGGCAGGG + Intronic
1081775897 11:45675779-45675801 CTGTTTCCACAGCCTGGCCCAGG - Intergenic
1082132989 11:48513778-48513800 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082139468 11:48591280-48591302 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082566417 11:54684336-54684358 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082569925 11:54726425-54726447 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082612624 11:55320015-55320037 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082618333 11:55390085-55390107 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082624649 11:55468323-55468345 CTCTTTGCAGAGACTGGAAAGGG + Intergenic
1082908136 11:58335267-58335289 CAGTTTGTAAAGACTGGGAAAGG - Intergenic
1083334861 11:61916689-61916711 CTTTCTGCACATACAGGGCAGGG + Intronic
1083513949 11:63238357-63238379 CTGGGTGTACAGTCTGGGCATGG + Intronic
1083756262 11:64793295-64793317 CAGGTTGCACAGACTGCACACGG + Intronic
1083833230 11:65246888-65246910 CTGTTTTCCCAGAGTAGGCATGG - Intergenic
1084011161 11:66349214-66349236 ATGTCAGGACAGACTGGGCAGGG + Intronic
1090057124 11:123432884-123432906 CTGTTTGCAACAACTGAGCATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093525751 12:20102243-20102265 CTGTATGAACAGCCTGGGCATGG - Intergenic
1093599378 12:21002884-21002906 CTGTGTGGACAGACTGGGAGGGG - Intergenic
1094138577 12:27155885-27155907 ATGATTGCACAGACTTAGCAAGG + Intergenic
1094338835 12:29388051-29388073 CAGATGGCACAGACTGTGCATGG - Intergenic
1094863587 12:34500583-34500605 CTTTTTGTACAGTCTGTGCAGGG - Intergenic
1095843725 12:46722927-46722949 CTGTTTTCTCAGACCTGGCAGGG + Intergenic
1095990117 12:48028700-48028722 CTGTTTGCCTTCACTGGGCAGGG + Intergenic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1096780370 12:53988373-53988395 ACGTATGCACAGACTGGGCAGGG + Intronic
1096833722 12:54334561-54334583 AAGTTGGCACAGGCTGGGCACGG + Intronic
1098877741 12:75884168-75884190 CTCCTTGCACACACTAGGCATGG + Intergenic
1100480905 12:94977971-94977993 CTGTTTCCCCAGATTTGGCATGG - Intronic
1101842682 12:108339530-108339552 CTGTTTGCGCTCAGTGGGCACGG - Intergenic
1102483362 12:113239325-113239347 CTGTTTGAGATGACTGGGCAGGG + Intronic
1102623153 12:114213053-114213075 CTGTATGCAGTGACTGAGCAAGG - Intergenic
1102744984 12:115242531-115242553 CTAACTGCAAAGACTGGGCATGG - Intergenic
1102757629 12:115355988-115356010 CTGTGTGCAGAGACCAGGCAGGG - Intergenic
1104964276 12:132502020-132502042 CTGTTTGTACAGAGAGTGCATGG + Intronic
1105600659 13:21884168-21884190 CCATCTGCACAGACTGGGCTAGG - Intergenic
1108133132 13:47325171-47325193 CTGTTTGCCCAGAATGCTCAGGG - Intergenic
1110593455 13:77291804-77291826 CTTTTTCCTCAGAGTGGGCACGG - Intronic
1110999398 13:82159436-82159458 ATGTTTGCCCAGAGTGGGCAGGG - Intergenic
1111556323 13:89885435-89885457 ATGTTGGCACAGCCTGGCCATGG + Intergenic
1112351730 13:98640797-98640819 GAGTTTGCACAGGCTGGGCACGG - Intergenic
1112461312 13:99606131-99606153 CTGTTGGCACTCTCTGGGCAGGG - Intergenic
1113855100 13:113439411-113439433 CTGTAGGCCCAGGCTGGGCACGG - Intronic
1116502673 14:45639348-45639370 ATGTTTTCACAGACTGGGGTTGG + Intergenic
1116559260 14:46357571-46357593 CTTGTGGCATAGACTGGGCAAGG + Intergenic
1118345323 14:64936254-64936276 CTATGGGCACAGACTGGGCTAGG - Intronic
1120249332 14:82043109-82043131 CTGTTTGCCATCACTGGGCATGG - Intergenic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121114411 14:91333545-91333567 CTGTGTGCACACACAGGACACGG + Intronic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1122951743 14:105048764-105048786 CTGTTTACTCAGGCTGGGCGCGG - Intergenic
1123122118 14:105921576-105921598 TTCTTTGCACAGACTGGCCAGGG + Intronic
1123404786 15:20013141-20013163 TTCTTTGCACAGACTGGCCAGGG + Intergenic
1123514117 15:21019788-21019810 TTCTTTGCACAGACTGGCCAGGG + Intergenic
1124245271 15:28065117-28065139 CACTTTGCAAAGACTGGGAAAGG - Intronic
1126875987 15:53041751-53041773 CTATTTGCAAGGACTGGGAAAGG - Intergenic
1130611117 15:85362017-85362039 CTGTCAGCACAGACAGGCCAAGG + Intergenic
1135238381 16:20780053-20780075 ATGTTTGCTGAGGCTGGGCATGG - Intronic
1135922881 16:26667073-26667095 CACTTAGCACACACTGGGCACGG + Intergenic
1136081389 16:27854526-27854548 CTGTTCACTCAGACTGGGAAAGG - Intronic
1140011262 16:71133689-71133711 CTGTATTCAGAGACTTGGCATGG - Intronic
1140972480 16:80027113-80027135 CTGTCCCCACAGACTGGGGAGGG - Intergenic
1142212926 16:88816898-88816920 CTGTTTACACGGGCTGGGCGTGG - Intronic
1143585854 17:7849863-7849885 TCGGTTTCACAGACTGGGCAGGG - Exonic
1143881188 17:10031227-10031249 ATGTTTGTCAAGACTGGGCAGGG + Intronic
1143972034 17:10803026-10803048 GTGTGTGCACTGAGTGGGCATGG + Intergenic
1143976192 17:10831746-10831768 CTGATGCCCCAGACTGGGCAAGG + Intronic
1144102635 17:11955930-11955952 TTGTTTGCACAGTCTGGATATGG + Intronic
1146132972 17:30294368-30294390 CTCTGTGCACAGCCTGGGCCAGG - Intergenic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1151855176 17:76716029-76716051 TTGTTTGCATAGAGTGGGAACGG - Exonic
1152117058 17:78394843-78394865 CTGTTTCTTCAGGCTGGGCACGG - Intronic
1152641372 17:81450637-81450659 CTGTGTTCAGAGACCGGGCAGGG + Intronic
1154502441 18:15003535-15003557 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
1156477185 18:37413007-37413029 GTGTGTGCACAGCCTGGGCGGGG - Intronic
1160257025 18:77255893-77255915 CTGTTTGCAGAGAATGCCCAGGG - Intronic
1160931606 19:1573012-1573034 TTTTTTGTACAGGCTGGGCAAGG - Intergenic
1164732072 19:30513936-30513958 CTGTGTGCACTGACTGGTGAGGG + Intronic
1164863215 19:31580281-31580303 TTGTCTGAACAGAATGGGCATGG - Intergenic
1165769372 19:38369915-38369937 GAGTTGGCACAGACTAGGCATGG + Intronic
1166600434 19:44089325-44089347 CTGTTTCCACAAACTTGGGAAGG + Exonic
1167028939 19:46943859-46943881 CTGTCTGCACAGCCAGGGCACGG + Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1168423439 19:56220154-56220176 CTGATTGAGCAGACCGGGCATGG - Exonic
925744182 2:7030700-7030722 GTTTTTCCACAGACTGGGCAGGG + Intronic
926177337 2:10606332-10606354 CTGCCTGCACAGACTGGGCGTGG + Intronic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927445948 2:23161712-23161734 CTGGTAGCACTGAATGGGCAAGG - Intergenic
928660294 2:33495243-33495265 GTTTTTCCACAGACAGGGCAGGG + Intronic
929647022 2:43637663-43637685 CTGTTTGGAAACACTGGGCCCGG + Intronic
930060199 2:47282120-47282142 CTCTTAGAAGAGACTGGGCATGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
932467539 2:71933281-71933303 CTGTTGGCCCAGCCTGGGCTCGG - Intergenic
932973211 2:76571056-76571078 CTCTCAGCACAGATTGGGCAGGG + Intergenic
932975531 2:76595602-76595624 CTGACTGCACAGTCTGGGGAGGG + Intergenic
935565161 2:104598525-104598547 ATTTTTCCACAGACTGGGTAGGG + Intergenic
937360176 2:121224204-121224226 TAGCTTTCACAGACTGGGCAGGG + Exonic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938501616 2:131833707-131833729 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
940183702 2:150960644-150960666 GTGCCTGCACAGACAGGGCACGG - Intergenic
940270312 2:151882965-151882987 CTGTCTGCCAACACTGGGCATGG + Intronic
940406765 2:153312715-153312737 TTGTTTGCTCTGACTGGGCTAGG + Intergenic
940990698 2:160093132-160093154 GTTTTTCCACAGACTGGCCAAGG + Intergenic
947021844 2:225686771-225686793 GTGTTTCCACACAGTGGGCAAGG - Intergenic
947475885 2:230447404-230447426 CTAATTGCCCAGACTTGGCACGG + Intronic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948665867 2:239534651-239534673 CTGTTTCTACAGTCTGGGCCAGG - Intergenic
1168742297 20:202102-202124 CTTCTTGAACACACTGGGCATGG - Intergenic
1169031164 20:2408228-2408250 CTGGTTCCACAGACAGAGCAAGG - Intronic
1170178379 20:13498632-13498654 GTGTTTGTTCAGGCTGGGCATGG - Intronic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1170737942 20:19027084-19027106 GTGTCTGAACAGACTGGGCCTGG - Intergenic
1172250361 20:33475218-33475240 CTGTTTGCTCAAATTGTGCATGG - Intergenic
1174094572 20:48078078-48078100 CTGTTTTCAGAGACTAGGAATGG - Intergenic
1174329938 20:49810115-49810137 CTCTTTACAGAGACTGGTCAGGG + Intergenic
1174491944 20:50905920-50905942 CAGTTAGTACACACTGGGCATGG + Intronic
1174777850 20:53362155-53362177 CTGTGTGAAGAGGCTGGGCACGG - Intronic
1176272814 20:64245271-64245293 CTGTGTCCACATGCTGGGCAGGG - Intergenic
1176993957 21:15532133-15532155 CTGTTTGCACAGTATAGGCAAGG + Intergenic
1177035745 21:16040393-16040415 CTGTTTGAGCAGACTAGGCATGG + Intergenic
1178868985 21:36355657-36355679 CTGTTCAAACAGGCTGGGCATGG + Intronic
1179012708 21:37568424-37568446 CTATCTGCTCAGAATGGGCATGG - Intergenic
1179578208 21:42320956-42320978 ATGTGAGCACAGACGGGGCAGGG + Intergenic
1180001324 21:44996780-44996802 GTGTTTGCACGGCCTGGTCAAGG + Intergenic
1181088735 22:20457744-20457766 CTCTTTGCACATCCTGGGGAAGG + Intronic
1181780333 22:25188008-25188030 ACGTTTGAACAGGCTGGGCATGG + Intronic
1183755944 22:39764768-39764790 CTGATTGCACAAAAGGGGCAGGG - Intronic
1185184044 22:49381933-49381955 CTGTTCCCCCAGACTGTGCACGG - Intergenic
950415943 3:12869123-12869145 CTCTTTGCCCAGGCTGGGCGGGG + Intronic
950417391 3:12876238-12876260 CTCTTTGCCCAGGCTGGGCGGGG + Intergenic
952957793 3:38568384-38568406 CTTTTGGTACAGACTGGGAATGG + Intronic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
954066079 3:48107317-48107339 CTGCTTTCAAGGACTGGGCAAGG - Intergenic
954499256 3:50995287-50995309 CTGTTTAAACAGACTAGGTATGG + Intronic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
955958567 3:64316136-64316158 CTGTTTGCTCAGACTTGTCTTGG - Intronic
956091052 3:65667455-65667477 TGTTTTGCACAGACTGGGGAAGG + Intronic
962126665 3:132626752-132626774 TTGTTTGTACAGACTCGGAAAGG - Exonic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966224388 3:177582312-177582334 CTCTTTGCACAGAGGAGGCAGGG + Intergenic
966748679 3:183301940-183301962 CTGTTTGCACAAACAGTTCAGGG - Intronic
967294787 3:187954469-187954491 CTGGTGGCCCAGACTGGGCTGGG - Intergenic
969872301 4:10112192-10112214 CTCTGTGCAAAGACTGGGAAGGG - Intronic
970929855 4:21496892-21496914 ATTTTTGCACAGACAGAGCAGGG - Intronic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
972607062 4:40623274-40623296 CTGTTTGCACCAAATGGGAAGGG + Intronic
973243050 4:47979028-47979050 ATCTTGGCACAGGCTGGGCATGG + Intronic
973735416 4:53866492-53866514 TTGTTTGGACATTCTGGGCAAGG - Intronic
976246426 4:83010607-83010629 CAGTTTGGACAAACTGGGAAAGG - Exonic
976315196 4:83652662-83652684 AGGTATGCACAGGCTGGGCACGG - Intergenic
976510143 4:85899032-85899054 ATGTATACACAGGCTGGGCATGG - Intronic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
982187589 4:152818652-152818674 CTGCTTCCACAGACTGGGAATGG + Intronic
983510577 4:168605645-168605667 CTGTCTGGACACACTGGGCTTGG + Intronic
984246570 4:177281945-177281967 TTATTTGCCCAGGCTGGGCATGG - Intergenic
986202232 5:5589142-5589164 CTGTTTGCACATAGTTTGCAGGG - Intergenic
990952270 5:61310251-61310273 CTATGAACACAGACTGGGCACGG + Intergenic
991961026 5:72044377-72044399 CTGTTGCCAAAGAATGGGCAAGG + Intergenic
994230713 5:97308139-97308161 TTGTTTATACAGTCTGGGCATGG - Intergenic
995501045 5:112807190-112807212 CACTTTCCACAGGCTGGGCATGG - Intronic
996465916 5:123802699-123802721 CAGTGTCCACAGACTGGGAAGGG + Intergenic
997844693 5:137275983-137276005 CAGTGTGAACAGCCTGGGCAGGG - Intronic
998448400 5:142216043-142216065 CTCTCTGCACAGACTGGTTAAGG + Intergenic
999018446 5:148135660-148135682 CAGTTGGTACAGACTGGTCATGG + Intronic
999753232 5:154645886-154645908 GTGTTAGCACAAACCGGGCATGG + Intergenic
1002408653 5:179055781-179055803 CTCTTTGCAAAGACTGGGCTGGG + Intergenic
1002486934 5:179545263-179545285 ATGTTTGCCTAGGCTGGGCACGG - Intergenic
1002921814 6:1578305-1578327 CTGTTGTCACAGACTGGCCACGG + Intergenic
1003197810 6:3930490-3930512 CTGTCTGCCAAGACTGTGCATGG + Intergenic
1003443574 6:6165090-6165112 CTTTTTGAACAAACTTGGCATGG + Intronic
1005093245 6:22081328-22081350 TTTTTTGTAGAGACTGGGCATGG - Intergenic
1006305468 6:33215745-33215767 CTCTCAGCACAGCCTGGGCAAGG + Intergenic
1008797277 6:55319758-55319780 CTGTTTGATAAGACTGGGAAAGG - Intergenic
1009842519 6:69094070-69094092 CTGTTTGCACAGTGGAGGCAAGG + Intronic
1010021750 6:71168248-71168270 CTGTCTACAAATACTGGGCAGGG + Intergenic
1010524198 6:76880333-76880355 CTGTTTCTTCAGGCTGGGCATGG - Intergenic
1012103772 6:95126392-95126414 ATGTCTGCAAAGAATGGGCATGG + Intergenic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013576890 6:111492477-111492499 CTTTTTACTGAGACTGGGCAGGG + Intergenic
1017381911 6:153841055-153841077 CTGTTTTCTCAGCCTGGGTATGG - Intergenic
1018345346 6:162893320-162893342 CAGTGTGGACAGACAGGGCAGGG + Intronic
1019261055 7:82242-82264 CTGTGTGCACAGCCTGTGCCTGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1021095289 7:16528383-16528405 CTGGTGGAACAGACTGGTCAAGG - Intronic
1021743334 7:23710726-23710748 CTGTTTGCAGAAAGTGGGTACGG + Intronic
1021941476 7:25683028-25683050 CTGTTTTCACAGTCTTTGCAAGG - Intergenic
1022006279 7:26268362-26268384 TTGTTTGCAGAGACTGGGTCTGG + Intergenic
1022558568 7:31325519-31325541 CTGTCTGCTCAGCTTGGGCAGGG - Intergenic
1023582682 7:41699650-41699672 CTGGTTTCACAGGCAGGGCAAGG + Intronic
1024941399 7:54767052-54767074 CTGGTTGCAGAGAGTGGCCATGG + Intergenic
1027428764 7:78088497-78088519 CTGTTTTCGAAGAATGGGCAGGG + Intronic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1029960537 7:104685421-104685443 GTGTTTACACACACTGGGCTAGG - Intronic
1031740838 7:125428258-125428280 CTGTTCTCACAGACTGGAGAAGG + Intergenic
1032895124 7:136241660-136241682 CTATTTGCAGAGACTTGGGAAGG - Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1035552236 8:537574-537596 TGGTTTGCACACACTGGCCATGG + Intronic
1037813431 8:22099659-22099681 CTGTCTGCACACACCGGGCCTGG + Intronic
1039312848 8:36337591-36337613 CAGTGTGCAGAGGCTGGGCATGG - Intergenic
1039366892 8:36937709-36937731 CTATGTGTACAGACTGGCCAGGG - Intergenic
1039510949 8:38091396-38091418 CTGTTTGCACTGTCAGGGAAAGG + Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1042247482 8:66722560-66722582 ATCTTTGCAGAGGCTGGGCACGG - Intronic
1048689669 8:136947385-136947407 CTGTTTCCATACAGTGGGCATGG - Intergenic
1050569403 9:6921828-6921850 GTGTTGGTACAGAGTGGGCAAGG - Intronic
1051683917 9:19637290-19637312 CAGTGGGCAGAGACTGGGCAGGG + Intronic
1053366184 9:37524121-37524143 CTGTGAGAACAGACTTGGCATGG - Intronic
1056232155 9:84557781-84557803 CTGTAGGAATAGACTGGGCATGG + Intergenic
1057011265 9:91603850-91603872 CTATTTTCACAGAGAGGGCAAGG - Intronic
1058561383 9:106232683-106232705 CTGTTGGTAGAGACTGGGCTTGG + Intergenic
1060260195 9:122067791-122067813 CCTTTTGCTCAGGCTGGGCATGG - Intronic
1060744917 9:126124960-126124982 CTGTTTCCAAAGGCTGGGAAAGG + Intergenic
1060931513 9:127492188-127492210 CTGATGGCACAGGCTGGGCCTGG - Intronic
1060954854 9:127631372-127631394 ATGTGTCCAGAGACTGGGCAGGG - Intronic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1062252603 9:135605759-135605781 CTGATGGCATAGGCTGGGCATGG + Intergenic
1062498056 9:136840842-136840864 CTGTTTACAGAGGCTGGGCAGGG + Exonic
1190458854 X:50651067-50651089 TTGTTTCAACACACTGGGCATGG - Intronic
1194762737 X:97813804-97813826 CTGTTATCTCAGAATGGGCACGG + Intergenic
1196604827 X:117645270-117645292 ATGATTTCACAGGCTGGGCATGG + Intergenic
1198047025 X:132913365-132913387 CTGTTTGCTCAGGCTGTGGATGG + Intronic
1198194201 X:134343579-134343601 CTGTGTGAACAGACTTGCCAAGG - Intergenic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1201170251 Y:11253494-11253516 AATTTTGCACAGACTGGGAAGGG + Intergenic