ID: 1033014387

View in Genome Browser
Species Human (GRCh38)
Location 7:137657313-137657335
Sequence CACAGCAGGGCCAAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033014379_1033014387 21 Left 1033014379 7:137657269-137657291 CCATTTCACTGATGAGAAAACTG 0: 5
1: 98
2: 1036
3: 4171
4: 10431
Right 1033014387 7:137657313-137657335 CACAGCAGGGCCAAGTGGTCTGG No data
1033014383_1033014387 -3 Left 1033014383 7:137657293-137657315 CCAAGGTCAGTGAATTAAGGCAC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1033014387 7:137657313-137657335 CACAGCAGGGCCAAGTGGTCTGG No data
1033014382_1033014387 -2 Left 1033014382 7:137657292-137657314 CCCAAGGTCAGTGAATTAAGGCA 0: 1
1: 0
2: 3
3: 18
4: 158
Right 1033014387 7:137657313-137657335 CACAGCAGGGCCAAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033014387 Original CRISPR CACAGCAGGGCCAAGTGGTC TGG Intronic
No off target data available for this crispr