ID: 1033017825

View in Genome Browser
Species Human (GRCh38)
Location 7:137690062-137690084
Sequence CAGAGCTCAAAATTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033017823_1033017825 -4 Left 1033017823 7:137690043-137690065 CCAACATCAGAATCTCATACAGA 0: 1
1: 0
2: 4
3: 25
4: 322
Right 1033017825 7:137690062-137690084 CAGAGCTCAAAATTTCCCATGGG 0: 1
1: 0
2: 3
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033017825 Original CRISPR CAGAGCTCAAAATTTCCCAT GGG Intronic
900114867 1:1024125-1024147 CAGAGCTCCACATGTCCCACCGG - Intronic
902398985 1:16147283-16147305 CAGGGCCACAAATTTCCCATTGG - Intronic
904995287 1:34626733-34626755 TAGAGCTCAACATTTCCATTTGG - Intergenic
905020665 1:34808775-34808797 CAAAGCTGAAAATTTTCCAAAGG + Intronic
905417308 1:37812810-37812832 CCTACCTCAAAACTTCCCATGGG + Exonic
905445642 1:38027075-38027097 CATAGCCCCAAGTTTCCCATAGG + Intergenic
905589543 1:39150705-39150727 CAGAGCTGAAAATTTACCATTGG - Intronic
905656289 1:39688151-39688173 CAGAGCTCTGATTTTCCCAGAGG - Intronic
910520567 1:88117333-88117355 CAGAGCTGAAAATTTTCTCTTGG - Intergenic
910791302 1:91053993-91054015 CACAGCTCAAAATTAACCACTGG + Intergenic
914688875 1:150007843-150007865 CACAGCTCCTAAGTTCCCATAGG + Intronic
916651271 1:166836798-166836820 CAGAGATCAAAAGCTCCCAGAGG + Intergenic
917587789 1:176445474-176445496 ATGAGCTCTAATTTTCCCATTGG + Intergenic
918584540 1:186170654-186170676 CAGAGCTCAAAAGCTCAAATAGG + Intronic
920452122 1:206067372-206067394 CTGAGCTCAAAGTTTCCCAAAGG + Intronic
921108853 1:212013116-212013138 CAGAGCTGAAAAATTCATATTGG + Intronic
921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG + Intergenic
922565865 1:226601462-226601484 CAGAGCTCACTTTTTCCCAAAGG + Intronic
922565936 1:226601854-226601876 CAGAGCACAACTTTTCCCAAGGG - Intronic
924417713 1:243875620-243875642 GAGAGCTCAAATGTTACCATTGG - Intergenic
1063007409 10:1986742-1986764 CATAGCATAAAATTTACCATAGG - Intergenic
1063262433 10:4405492-4405514 TTGAGCTCAAAATTTCCCCCTGG + Intergenic
1068320579 10:55408863-55408885 GAGAGCTTAAAATTGTCCATCGG - Intronic
1069752517 10:70753362-70753384 CAGATCCCCCAATTTCCCATGGG - Intronic
1072233851 10:93436630-93436652 CAGAGCTCAGACTTATCCATGGG - Intronic
1072805248 10:98419875-98419897 CAGAGGTCACATTTTCACATGGG - Intronic
1074156960 10:110807805-110807827 CAGAACATAAAATTCCCCATGGG - Intronic
1074650396 10:115516565-115516587 CATAGCTCAAAACTTTCCATGGG + Intronic
1075586407 10:123661450-123661472 CAGAGCTCCAGATTTCCCCAAGG + Intergenic
1075700728 10:124468010-124468032 CAGGGCTCAAACTGTCCCTTGGG - Intronic
1078531304 11:12138879-12138901 CAGGGCACAAAGGTTCCCATAGG - Intronic
1079985677 11:27198071-27198093 CAGAGCTAAAGACTTTCCATAGG + Intergenic
1085804663 11:79624209-79624231 CAGTTTTGAAAATTTCCCATTGG + Intergenic
1086884619 11:92190738-92190760 CAGAGCTCAATCTTTCACAATGG + Intergenic
1088387528 11:109275875-109275897 CAGGGCTCAGAATTTTCCACAGG + Intergenic
1089971102 11:122693967-122693989 CAGAGCTTCAAATGTCACATAGG - Intronic
1090712312 11:129398651-129398673 CAGGGTTCTAAATTTCCAATGGG - Intronic
1092076603 12:5678544-5678566 CTGAGTTCAAAATTTTCCAAGGG + Intronic
1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG + Intronic
1093944184 12:25088180-25088202 CAGAGAACAAAAGTTCACATGGG - Intronic
1095125232 12:38469437-38469459 CAGAGGCCAAATTTTCCCTTAGG - Intergenic
1099424053 12:82501150-82501172 TTGAGCTCAAATTTTCCTATGGG - Intergenic
1100614333 12:96219436-96219458 CAGAGGGCAAAATTTCCAACTGG + Intronic
1101609849 12:106281052-106281074 AAGAAATAAAAATTTCCCATTGG + Intronic
1101748032 12:107558993-107559015 CAGAGCTCAAAGTTTGGCAGTGG - Intronic
1103282713 12:119773372-119773394 TATATCTCAATATTTCCCATAGG - Intronic
1105759534 13:23501166-23501188 CAGAGAGTAAAATTTCCCATGGG - Intergenic
1107343537 13:39435346-39435368 GAAAGCTCAAATTTTACCATTGG - Intronic
1108765532 13:53624466-53624488 CAGAATTCAAAATGCCCCATTGG + Intergenic
1110147681 13:72212152-72212174 CAAAGCTAGAAATTTCCCAAAGG + Intergenic
1112556270 13:100471609-100471631 CACAGTTCAAATTTGCCCATCGG + Intronic
1114546521 14:23506633-23506655 GAGAGCTTAAAATTTCCCTGAGG + Intronic
1116074850 14:40098346-40098368 CAGAGCTCCAAAGTTCCTCTGGG + Intergenic
1116986741 14:51227965-51227987 CACAGCTCAAAATTCTCCAGTGG - Intergenic
1117457674 14:55914020-55914042 CAGAGATCAAATTTTGCCAGTGG - Intergenic
1117711403 14:58532763-58532785 CAGAGGTCAAAATTACTCTTGGG + Intronic
1120501711 14:85305592-85305614 CAAAGCTAAAAATTTAACATTGG - Intergenic
1120555070 14:85919784-85919806 CAGAGCTCATAATTTTCTCTTGG + Intergenic
1121046049 14:90788662-90788684 TAGAGCTCAAAAATTCCTTTAGG + Intronic
1121404939 14:93714012-93714034 CAGAGTTCAAAAGTCTCCATGGG + Intergenic
1122452384 14:101820224-101820246 GAAAGCTCAAATTTTACCATGGG - Intronic
1125447075 15:39769369-39769391 CAAAGCTCAAATTTTACCATTGG + Intronic
1130921182 15:88346089-88346111 CAGAGCTGAAAATTGCCCATTGG - Intergenic
1131371583 15:91886219-91886241 CAGAGCACAAAAATCCACATTGG + Intronic
1135749942 16:25049666-25049688 TAGAGCTGAAAAATTCCCGTGGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1143836876 17:9699931-9699953 CAGAGCTCACAAGCTCCCATGGG + Intronic
1144762869 17:17717253-17717275 CAGGGCTCAAACTTACCCCTGGG - Intronic
1146083413 17:29804476-29804498 CAGAGCTCAGATTTTTCTATAGG - Intronic
1146180709 17:30696656-30696678 CTGAGCTTTAAATATCCCATGGG - Intergenic
1148538647 17:48462133-48462155 CACAGCTCAAAATTACTCAGTGG - Intergenic
1149351859 17:55797397-55797419 CAGAGCTCATACATTCTCATGGG + Intronic
1149473368 17:56937814-56937836 CTGAGGTCAAAATTTTCCTTTGG + Intergenic
1152991662 18:368910-368932 CAAAAATCACAATTTCCCATGGG + Intronic
1154935973 18:21057048-21057070 AAGAGGTCAAAATCTGCCATAGG - Intronic
1157661735 18:49451386-49451408 CAGAGCTGAAAAAGCCCCATGGG + Intronic
1158304946 18:56095137-56095159 GAGAACTCAATATTTCCCTTAGG + Intergenic
1159796043 18:72845271-72845293 CAGAGCTCCAGATTTCTCATGGG - Intronic
1162977871 19:14218878-14218900 CTGAGCTTTAAATATCCCATGGG + Intergenic
1163647249 19:18496368-18496390 AAGAGCTCAAAATCTCCCTGAGG + Intronic
1165274593 19:34737378-34737400 CAGAGCTAAAAAATTACCACAGG + Intronic
925451695 2:3974566-3974588 CCGAGATCTAAACTTCCCATGGG + Intergenic
928732213 2:34244511-34244533 CAGAGCTCAAAAATTGGCCTTGG + Intergenic
929176469 2:38982315-38982337 TAGAGCTCAAAATATTTCATTGG + Exonic
934546965 2:95225789-95225811 CAGAGCTGGAAATTTGCCTTAGG - Intronic
935533157 2:104260713-104260735 AAGAGCTCAAGAGTTCCCTTTGG + Intergenic
936977910 2:118237652-118237674 GAGAGCTGAAAATGTCCCCTTGG - Intergenic
937050968 2:118889325-118889347 CAGAACTCCAAAGTCCCCATAGG + Intergenic
944590115 2:201209217-201209239 GACAGCTCCAAATCTCCCATGGG - Exonic
945131018 2:206572214-206572236 TAGTGCTCATATTTTCCCATTGG + Intronic
946644995 2:221823779-221823801 CACAGATGAAAACTTCCCATGGG - Intergenic
947000523 2:225450407-225450429 CAGAGCTCAAAAATTCCACTAGG - Intronic
947838069 2:233189406-233189428 CAGAGCACAGAATTTCTCCTTGG - Intronic
1169057262 20:2633865-2633887 CAGAACTCAAAATTAACCAAAGG - Intronic
1169690927 20:8331131-8331153 CAAAGGTCAAAATTACCCAGTGG + Intronic
1169865026 20:10190739-10190761 CAGATCTAATAACTTCCCATGGG - Intergenic
1170231554 20:14052368-14052390 CAGATCTAAACATTTCCCATTGG - Intronic
1172415718 20:34765596-34765618 CAGGGGACAAAATTTCCCCTAGG - Intronic
1173326268 20:42036485-42036507 CAGAGCTCAATATTCTCCCTGGG + Intergenic
1174115421 20:48223561-48223583 CAGAGCTCAGAGTTTTCCCTTGG - Intergenic
1174718208 20:52783250-52783272 CAGAGCTCAGAGTTTCCTAGTGG + Intergenic
1177096763 21:16845146-16845168 CAGGGCAAAAAATTGCCCATTGG + Intergenic
1177932177 21:27298656-27298678 TAGAGCTCCAATTTTCCCAATGG - Intergenic
1182459642 22:30474666-30474688 TAGAGCTCACAGTCTCCCATTGG + Intergenic
949220797 3:1631486-1631508 CAGAGCTCTAAACTCCCCTTTGG - Intergenic
949350441 3:3120084-3120106 CAGTGCTCACAATTTGCCAGTGG - Intronic
949924118 3:9027465-9027487 TAGAGCTCAAAATTTCCACCAGG - Intronic
952538378 3:34338341-34338363 CAGAGTTCAAAGTTTCACTTAGG + Intergenic
952988577 3:38810967-38810989 CAGAGCAAAATATTTTCCATTGG + Intergenic
953460556 3:43078605-43078627 CAGAGGTCAAAAACTCCCATGGG - Intergenic
954639776 3:52090959-52090981 CAGCGCTTAAAATCTCCCCTTGG + Intronic
955107592 3:55913660-55913682 CATAGATCAAAATTCTCCATTGG - Intronic
955579750 3:60405900-60405922 CTAAGCTCCAATTTTCCCATTGG + Intronic
955767475 3:62360021-62360043 CAGAGCTCCAAATTGCCCATTGG - Intergenic
956939797 3:74144878-74144900 AACAGCTCATAATTTGCCATGGG - Intergenic
957877457 3:86166598-86166620 CCGAGCACAAAATTTCAAATGGG - Intergenic
958441228 3:94158510-94158532 GAGAGCTCATTATTTTCCATTGG + Intergenic
959668383 3:108946434-108946456 CAGAGAACAAAATGTACCATAGG - Intronic
961558400 3:127712221-127712243 CAGAGCTCTAACCTTCCCGTGGG + Intronic
963653712 3:148018478-148018500 CAGAGCTCAAAGTTTTGCAGTGG - Intergenic
963793642 3:149609609-149609631 CAGAGCTGAAAATTTACAACAGG + Intronic
965844950 3:172950298-172950320 CAGAGCACCATACTTCCCATTGG + Intronic
966842946 3:184104340-184104362 CAGAGATCACAGTTTACCATTGG + Exonic
967223063 3:187265497-187265519 TATGGCTCAAATTTTCCCATGGG - Intronic
967621936 3:191643711-191643733 TAGAGCTAAAAATTTACTATAGG + Intergenic
969004086 4:4005401-4005423 CACAGCACCAAATTTCACATGGG + Intergenic
969809821 4:9639314-9639336 CACAGCACCAAATTTCACATGGG - Intergenic
971914966 4:32857183-32857205 CAAAGCTGAAAATTTCCCAAGGG + Intergenic
972644439 4:40954286-40954308 CAGAGCACAAGATTTCCCTCGGG + Intronic
973133512 4:46677349-46677371 CACTGCTCAAAACTTTCCATTGG + Intergenic
974631554 4:64496294-64496316 TATAACTCAAAATATCCCATAGG - Intergenic
976447168 4:85143425-85143447 TAGAGCTCTGATTTTCCCATTGG - Intergenic
979409188 4:120353806-120353828 CAGATCATAAAATTTCCCAGGGG - Intergenic
979754860 4:124327781-124327803 CAGAATTCAAGATTACCCATAGG - Intergenic
980500190 4:133640849-133640871 AAGATGACAAAATTTCCCATTGG + Intergenic
982354296 4:154449796-154449818 CATTGCTAAAAATTTCCCTTAGG + Intronic
983173392 4:164560268-164560290 CAGAGTTGAAAATTACCTATTGG - Intergenic
984170711 4:176355948-176355970 CAGTTCTCAAAATTTGGCATAGG - Intergenic
984312569 4:178081730-178081752 CCTAGCTCTACATTTCCCATAGG - Intergenic
984424289 4:179563595-179563617 CTAAGCTCAAAATTTCCCTGGGG + Intergenic
984793572 4:183636576-183636598 CAGAGATGAAAATCTCCCGTAGG + Intergenic
985203936 4:187513354-187513376 CATAGCAACAAATTTCCCATTGG - Intergenic
987223095 5:15811048-15811070 TAAAGCTCATAATTTCTCATAGG - Intronic
988128394 5:27073101-27073123 CAGAGATCTGAATTCCCCATAGG + Intronic
988301944 5:29440779-29440801 CAGAGCTCAGGATTTCTCAAAGG - Intergenic
989219177 5:38935893-38935915 CAGAGCCCAGCATTTCCTATTGG - Intronic
989492797 5:42077197-42077219 CAGAGCTCTAATTTCCCCCTGGG + Intergenic
989637569 5:43553119-43553141 CAGAGCCAAAAATTTAACATAGG - Intronic
993190289 5:84671831-84671853 CAGAGCTCAAAATTGAGCAATGG + Intergenic
994306829 5:98214963-98214985 CAGATCTCGAATTTTCCCTTGGG + Intergenic
994754190 5:103774804-103774826 CAGAGTTCTAAATTTGCCCTTGG + Intergenic
999238086 5:150111836-150111858 CAGGGCTTAACTTTTCCCATTGG - Intronic
1000203994 5:159039735-159039757 AAGAGCTAAAAATGTCCCATTGG + Intronic
1000357603 5:160415810-160415832 CAGAGCTGAAAAATGTCCATTGG - Intronic
1001425325 5:171618763-171618785 CAGAGCTAAGAATGTCCCTTGGG + Intergenic
1001852581 5:174982441-174982463 CAGACCTTAAAACTTCCCAAAGG + Intergenic
1003068466 6:2923550-2923572 CAGTGCTCAAAATTTAGCAGGGG + Intergenic
1003244546 6:4373006-4373028 CAGAGCACCAAGTTTCCCAAGGG - Intergenic
1005352539 6:24950384-24950406 CAGAGCCCAAATTTTTCCAAGGG - Intronic
1005465846 6:26112273-26112295 CATAGCTGAAAATCACCCATAGG + Intergenic
1007320101 6:41022004-41022026 CAGAACTCAAAACTTCCCAAGGG + Intergenic
1008211879 6:48735147-48735169 AAAAGCTAAAGATTTCCCATAGG - Intergenic
1008298090 6:49802982-49803004 CAGAGCTCAAAACTTTCAGTAGG + Intergenic
1009255195 6:61382166-61382188 AAGAGCTCTAAATATCCAATTGG - Intergenic
1009386758 6:63093769-63093791 CAGTGCTCACAATCTCTCATTGG - Intergenic
1010165756 6:72913424-72913446 CACAACTCAAAGTCTCCCATTGG - Intronic
1015019164 6:128451062-128451084 AAGAGCTCAAATTTTGTCATTGG - Intronic
1015685550 6:135855609-135855631 GAGAGCCAAAATTTTCCCATAGG + Intronic
1016173661 6:141051497-141051519 CAGAGCTCAAATTTTCAACTTGG + Intergenic
1017639795 6:156481665-156481687 AAGAGCTCAAATTTTATCATTGG + Intergenic
1020648245 7:10842433-10842455 CAAAGCTCCAAATTCCACATTGG - Intergenic
1022660421 7:32361608-32361630 CAGAGATCACAATTTCCCCCAGG - Intergenic
1022688260 7:32617319-32617341 CAGAGCTAAGCATTTCCCTTGGG + Intergenic
1022722265 7:32951917-32951939 CAGAACTCCAAATTTCACATAGG - Intergenic
1022915840 7:34951616-34951638 CAGAGCTAAGTATTTCCCTTGGG + Intronic
1023098298 7:36686240-36686262 CTGATCTCAAAATTTCAAATGGG - Intronic
1023294445 7:38700379-38700401 AAGAGCTAAAAACGTCCCATTGG + Intergenic
1023730639 7:43188638-43188660 CAGAGCCCTCAATTTCCCTTTGG - Intronic
1024142346 7:46474959-46474981 GAGAACTCAAAATTTCTAATCGG + Intergenic
1024638866 7:51313707-51313729 CACAGGGCTAAATTTCCCATTGG - Intronic
1025050490 7:55730040-55730062 CAGAACTCCAAATTTCACATAGG + Intergenic
1025542860 7:62116317-62116339 AAGCGCTCAAAATATCCCTTTGG + Intergenic
1027824677 7:83095645-83095667 CATATCTTAAAATTTCCCTTGGG + Intronic
1030624861 7:111833055-111833077 CATATTTGAAAATTTCCCATAGG - Intronic
1031024370 7:116664007-116664029 CAGAACTCACAACTTCCCTTTGG + Intergenic
1031769560 7:125826733-125826755 GAGAGCTCAAATTTTATCATTGG - Intergenic
1032506614 7:132439862-132439884 CTGACCTCAAAAATTCCCAGTGG + Intronic
1033017825 7:137690062-137690084 CAGAGCTCAAAATTTCCCATGGG + Intronic
1033757394 7:144406156-144406178 CAAAGATCCAAATTGCCCATAGG + Intronic
1034625834 7:152491701-152491723 CAGAGCTCTAAGTCTCCCATAGG - Intergenic
1037690956 8:21181216-21181238 CAGAGATAAAACTTACCCATGGG - Intergenic
1040085523 8:43336403-43336425 AAGAGATTAAAATCTCCCATTGG - Intergenic
1040996034 8:53403413-53403435 CAAATATCATAATTTCCCATAGG + Intergenic
1042403512 8:68376956-68376978 CAGAGTTCCAAATTTCCCAGTGG + Intronic
1042716494 8:71778882-71778904 CAGTGGTCACAATTTCCCAGGGG - Intergenic
1042776127 8:72433542-72433564 CAGTGCTCAAAAGTTCCTCTTGG + Intergenic
1043407494 8:79952676-79952698 CAGAGTTCCTTATTTCCCATGGG + Intronic
1044554794 8:93551347-93551369 TAGAGCACAAAATTTCAGATAGG + Intergenic
1045371340 8:101526551-101526573 GAAAGCTCAAATTTTACCATTGG + Intronic
1045549490 8:103158000-103158022 CAGTGCCCAAATTTTCCCAATGG + Intronic
1046563055 8:115863757-115863779 GATAGCTCAACATTTCCCTTTGG + Intergenic
1048061593 8:130924647-130924669 CACAGCTCCAATTTTCTCATTGG + Intronic
1048425643 8:134320746-134320768 CAGAACTCATAACTTCCAATTGG - Intergenic
1048885820 8:138908759-138908781 CGGAGCTCAAAATCTATCATAGG + Intronic
1051087679 9:13369429-13369451 CAGAACTCAAATTTTTACATGGG + Intergenic
1052490342 9:29159016-29159038 CAGAGCTCAAATCATCACATGGG + Intergenic
1052780546 9:32778334-32778356 CATAGCTCCAAATTTCATATAGG - Intergenic
1052822061 9:33145387-33145409 CAAAGCTCAAAGTTTTACATGGG + Intronic
1058200887 9:102038894-102038916 CAGAGCAAAACATTTCCTATAGG + Intergenic
1059681220 9:116588202-116588224 CAGAGCTGAATTTTTCCCTTTGG - Intronic
1059913628 9:119074702-119074724 AGGAGCATAAAATTTCCCATTGG + Intergenic
1061127730 9:128687642-128687664 CAGAACTCACACTTTACCATTGG - Intronic
1062516120 9:136937419-136937441 CAGACTTCAACATTTCCCACAGG - Intronic
1188501357 X:30830498-30830520 CTGAGCTCAAGATTTCCAAATGG + Exonic
1188679785 X:32988538-32988560 CATTGCTCACAATTTCCCTTTGG + Intronic
1189776338 X:44473208-44473230 CAGAGCTCCAAAGCTCTCATTGG + Intergenic
1192827036 X:74708182-74708204 CAGAGCTCTTAATTGCTCATTGG + Intergenic
1192855212 X:75002155-75002177 GAGAGTTCAAATTTTACCATTGG + Intergenic
1198329889 X:135612537-135612559 CACAGCTCAACATTTTCCTTTGG + Intergenic
1198337108 X:135677226-135677248 CACAGCTCAACATTTTCCTTTGG - Intergenic
1199546933 X:149016140-149016162 CAAAGCTCAAATTTTGTCATTGG + Intergenic
1200759679 Y:7026410-7026432 CAGAGCTCAAAGCTTCCCAGAGG + Intronic
1201377294 Y:13336874-13336896 CAGAAATCTAAATTTCCTATGGG + Intronic