ID: 1033022145

View in Genome Browser
Species Human (GRCh38)
Location 7:137736470-137736492
Sequence CACAGCAACGTGAAGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033022145 Original CRISPR CACAGCAACGTGAAGAGGTA AGG (reversed) Intronic
900767415 1:4514423-4514445 CACTGCAATGTGAAGAGGAAGGG + Intergenic
902291613 1:15439116-15439138 CAAAACAACCTTAAGAGGTAGGG + Intronic
902797130 1:18807218-18807240 CACAGCCAGGGGAAGAGGCAGGG + Intergenic
905526756 1:38645786-38645808 CACAACAACCTGATGAGGTAGGG + Intergenic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
909523977 1:76601621-76601643 CACAACAACCTAATGAGGTAGGG + Intronic
910002910 1:82359443-82359465 CTCAGGAAAGTGAAGAGGTGGGG + Intergenic
912509022 1:110175858-110175880 CACAACAACGTTATGAGTTAGGG + Intronic
915251293 1:154590678-154590700 CCCAGCAACTTGAGGAGCTAAGG + Intronic
917620422 1:176789961-176789983 ACCAGGAACGTGAAAAGGTAAGG + Exonic
918520098 1:185406113-185406135 CACAGCTACAGGAAGAGGAATGG - Intergenic
919675746 1:200380828-200380850 CACAGAAAGATGAAGAGGTGGGG + Intergenic
919911967 1:202116885-202116907 CACAGCAACCTTATGAGGTAGGG - Intergenic
922278814 1:224102871-224102893 CACAGCAATGTTAAGAAGGAGGG + Intergenic
922410658 1:225371960-225371982 CACAACAACATTATGAGGTAAGG + Intronic
924647636 1:245893909-245893931 AACAGCATAGTGAAGAGGTTAGG + Intronic
1063957245 10:11278807-11278829 CACAACAACCTGATGAAGTAGGG + Intronic
1067692864 10:48513650-48513672 AACAGCAACCTGAGGAGGGAAGG + Intronic
1068780763 10:60916985-60917007 CACAGAAGCTAGAAGAGGTAAGG + Intronic
1071049161 10:81425302-81425324 AATAGCAACGTGAAGTGGAAAGG - Intergenic
1072664814 10:97385160-97385182 CACATCAACCTGGTGAGGTACGG - Exonic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1073569836 10:104570703-104570725 CAAAGCAATATGAAAAGGTAAGG - Intergenic
1074685523 10:115959302-115959324 CACAGTCATGTGAGGAGGTAAGG - Intergenic
1074726176 10:116312165-116312187 CACAGCTACCTGAAGAGGCAAGG + Intergenic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1080622263 11:33996711-33996733 CAGAGCAAAGTGCAGAGGTGGGG - Intergenic
1080688895 11:34538920-34538942 CACAGCAATGTTAAGCAGTAGGG - Intergenic
1083555153 11:63620281-63620303 CACAGCAACAGGAAAAGATAAGG - Intergenic
1083785862 11:64946545-64946567 CACATGTAGGTGAAGAGGTAGGG - Intronic
1084922742 11:72484353-72484375 CACAGCAGCCTGAAAAGATAGGG - Intergenic
1085109000 11:73871206-73871228 GACAGCAAAGTGAACAAGTAAGG - Intergenic
1085444049 11:76589087-76589109 CACAGCAGCGTGGAGAGGGCTGG + Intergenic
1085728978 11:78980285-78980307 CACAGCAATCTTAAGAGGTAGGG + Intronic
1086121246 11:83306560-83306582 CACAGCTACTTGAAAAGGAAAGG - Intergenic
1087092885 11:94293062-94293084 AACAGCAATGTAAAGAGGGAGGG + Intergenic
1088673150 11:112163957-112163979 CACAGCTTCGGGAAGAGGAAAGG - Exonic
1089162688 11:116451716-116451738 CATAGAAACTTGAAGAGGTAAGG - Intergenic
1090379111 11:126312887-126312909 CACAGCAACAGGAAGAAGAAAGG - Intronic
1093337263 12:17921209-17921231 CACAGCAACCTGGAGCGGGATGG - Intergenic
1097409633 12:59235466-59235488 CACAGAACCATGGAGAGGTAGGG - Intergenic
1105421811 13:20259164-20259186 CACACCACCGTGTAGAGGTGGGG + Intergenic
1111198278 13:84901358-84901380 CACAGCAGAGTAAAGAGGAAGGG + Intergenic
1115432912 14:33341982-33342004 CAGGGCATCGTGATGAGGTACGG - Intronic
1115819126 14:37195129-37195151 CTTAGCAAGGTGAAGAGGTGAGG - Intergenic
1116644657 14:47510961-47510983 AACAACAACTTGTAGAGGTAAGG - Intronic
1119194849 14:72709793-72709815 CACACCAACCTGGAGAGGCAGGG - Intronic
1122119889 14:99546668-99546690 CATAGCCACGTGGAGAGGCAAGG + Intronic
1122152480 14:99732420-99732442 AACAGGAACACGAAGAGGTACGG - Intergenic
1128393961 15:67204344-67204366 CACAACATCGTCATGAGGTAAGG + Intronic
1129294464 15:74592303-74592325 CAGAACAATGTGAAGAGGAAGGG - Intronic
1130608627 15:85340119-85340141 CACAGCTTTGTGATGAGGTAAGG - Intergenic
1131311067 15:91290267-91290289 AAAAGGAATGTGAAGAGGTAAGG + Intronic
1132124315 15:99208559-99208581 AACAGCAACCTGAGGAGGTGAGG - Intronic
1132796304 16:1724998-1725020 CTCAGCAGTGTGAAGAGGTGGGG - Intronic
1133191153 16:4134450-4134472 CACAGCAAGCTGAAGAGCCAAGG - Intergenic
1133396201 16:5449333-5449355 CAAAGCAACCTGAAGAGATGAGG - Intergenic
1135779601 16:25288744-25288766 CACAACAGCGTGTAGAGGTTAGG + Intergenic
1136591489 16:31220405-31220427 CACATAAAAGTGAAGGGGTAGGG + Intronic
1139099129 16:63744287-63744309 ACCAGCAACGTGATGGGGTATGG - Intergenic
1140073793 16:71677364-71677386 CATAGCAACAGGAAGAAGTATGG - Intronic
1143948899 17:10617536-10617558 CCCAGCATCTTGAAGAGTTATGG - Intergenic
1144709167 17:17388999-17389021 CACAGCAACGTCAGGAGGAGTGG - Intergenic
1148240254 17:45995702-45995724 CACAGCAGCATGAAGCGGTATGG + Intronic
1149559459 17:57597929-57597951 CACAGCAGCCTCAAGAGGAAGGG + Intronic
1150019228 17:61593775-61593797 CACAGCAACTTGCAGAGAGAAGG + Intergenic
1150384908 17:64751069-64751091 CGCAGAAACGTGAAGAGGGCTGG + Intergenic
1153140177 18:1962490-1962512 CACAGCAACTTTATGAAGTAGGG - Intergenic
1153140180 18:1962623-1962645 CACAGCAACTTTATGAAGTAGGG + Intergenic
1153475386 18:5493682-5493704 CACAGAAAAGTAGAGAGGTAGGG - Intronic
1156285906 18:35695665-35695687 CACAACAAGGTTCAGAGGTAGGG - Intronic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1156928814 18:42616393-42616415 CACAGCAATGTGGAGAAGGAAGG + Intergenic
1157588664 18:48821233-48821255 CAAGGCAACGTGAAGAGGCTGGG - Intronic
1158852592 18:61510230-61510252 CACACCAACATGAAGAGGTCAGG + Intronic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1160501940 18:79405946-79405968 CACAGAAACGTCAAGGGCTACGG + Intronic
1163711256 19:18848457-18848479 CACAGCAACCTGGAGGGGAAGGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166371989 19:42307026-42307048 CACAGCTACGTGAAGTGGGAAGG + Intronic
1168252875 19:55150350-55150372 CACAGCAAGGTGCAGAGACATGG - Intergenic
925288697 2:2732073-2732095 CACAGCAACGTGAAGGTGACCGG + Intergenic
928012889 2:27627626-27627648 CAGAGCAACCTGAGAAGGTATGG - Exonic
928061382 2:28116628-28116650 CACAGCAACCTGGAGAGGAGAGG + Intronic
929981534 2:46685330-46685352 CACAACAACATTAAGAGGCAAGG - Intergenic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
932440553 2:71731914-71731936 GACAGCAACTTCAAGAGGCATGG - Intergenic
934049299 2:88197156-88197178 CACAGACACGTGTAGAGGAAAGG + Intergenic
938152716 2:128901057-128901079 CACAGACACGTGCAGAGGGAAGG + Intergenic
939801673 2:146719115-146719137 AAAAGCAACGTGAAGAGATAGGG - Intergenic
942889242 2:180967243-180967265 CATAGCAATATGAAGAGCTACGG + Intronic
943757743 2:191574647-191574669 CACAGGAAGCTGAAGAGGTGAGG - Intergenic
947772586 2:232682354-232682376 CGGAGCAAGGTGAAGAGGGAGGG - Exonic
1168996850 20:2139640-2139662 CCCAGCAACCCTAAGAGGTAGGG - Intronic
1169914786 20:10674100-10674122 CCCAGCAACGTGAAGGGGAGGGG - Exonic
1174837615 20:53873147-53873169 CACAGGAACGGGGAGAGGGAGGG + Intergenic
1177076855 21:16586891-16586913 CACAGAAATGGGAAGAGGGAAGG - Intergenic
1179048928 21:37872076-37872098 CAAATCAAAGTGAAGAGGTATGG + Intronic
1179549194 21:42132692-42132714 CACAACAACCTTATGAGGTAGGG - Intronic
1181162963 22:20968411-20968433 CACAGCAACTCTAAGAGGTCAGG - Intronic
1183716518 22:39536347-39536369 CACAGCAGCCTTATGAGGTAGGG - Intergenic
1184604790 22:45566193-45566215 CATAGCAATGTGAAGAGGTGGGG + Intronic
950043967 3:9938028-9938050 CACAGCCACTGGAAGAGGTCCGG - Exonic
950160587 3:10757838-10757860 CACAGCAACCTTAAAAGGTGAGG + Intergenic
950564470 3:13759087-13759109 GACAGCATCATGAAGAGGGATGG - Intergenic
951669063 3:25160347-25160369 CAAAGTAATGTCAAGAGGTAAGG - Intergenic
952196928 3:31085544-31085566 CACTGGAACATGAAGAGTTATGG - Intergenic
952476483 3:33716328-33716350 CACAGCACCGAGTAGAAGTAGGG + Intronic
952745221 3:36770649-36770671 CGCAGCAATGTGGAGAGATAGGG - Intergenic
954913630 3:54130567-54130589 CCCAGCAACCTAATGAGGTAGGG + Intronic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955693122 3:61609202-61609224 CACAGCAAGGTATAGAGGGATGG - Intronic
962927493 3:140008390-140008412 CACAGCAGGCTGAAGAAGTAAGG - Intronic
964521172 3:157569897-157569919 CATAGGATGGTGAAGAGGTAAGG - Intronic
964760590 3:160131904-160131926 CAAAGCAGCATGAACAGGTAAGG + Intergenic
966270407 3:178097927-178097949 GACAGCAAAGTGAAGAGTCAGGG + Intergenic
969352405 4:6605313-6605335 CACAGCATCTGGGAGAGGTAAGG + Exonic
970551324 4:17184680-17184702 CACAGAATCTGGAAGAGGTAAGG + Intergenic
971042383 4:22768268-22768290 CACAGTGACCTGAAGAGTTAAGG + Intergenic
971290189 4:25330508-25330530 CACAGCCAAGTGAATAGGCATGG - Intronic
975196885 4:71536199-71536221 TACAGCAAAGTAAAGAAGTAAGG - Intronic
976250992 4:83051841-83051863 CACTTCAACGTTAAGAGGTTGGG + Intronic
981417393 4:144509240-144509262 CACAGCACCCTGGAGAGGGAAGG - Intergenic
985489104 5:168746-168768 CACAGTAACTTGAAAAGATAAGG - Intronic
988615775 5:32773468-32773490 CACACCAAGATGGAGAGGTAAGG - Intronic
988832831 5:35004220-35004242 CAGAACAAAGTGAAGAGTTAAGG - Intronic
990076080 5:51847528-51847550 CACAGCTACTTGAAAGGGTAAGG + Intergenic
992075814 5:73191764-73191786 CACAGCAACATTAAGAGGCTGGG - Intergenic
992476020 5:77102456-77102478 CACAACAACCTAAGGAGGTAGGG - Intergenic
995826237 5:116302745-116302767 CCTAGGAAAGTGAAGAGGTATGG + Intronic
998621189 5:143796008-143796030 CACAGCCATGTGAGGAGGTTAGG + Intergenic
999491624 5:152056836-152056858 CACAGAAAGTTGAAGAGGCAAGG + Intergenic
999664346 5:153897143-153897165 CACTCCTACATGAAGAGGTAGGG - Intergenic
1000628138 5:163562915-163562937 CACACCAACTTGAAGAGTGAGGG + Intergenic
1001143243 5:169162737-169162759 TACAGCAGCCTGAAAAGGTAAGG - Intronic
1001773986 5:174315191-174315213 GACAGCAAGGTGAAGAGATGGGG + Intergenic
1001864076 5:175087919-175087941 CAGTGCAACATGAAAAGGTAGGG - Intergenic
1004497504 6:16178656-16178678 CACCGCAACGTAAAGAGCAAGGG + Intergenic
1005165117 6:22910510-22910532 CACAGGAACTAGAAGAGGCAAGG + Intergenic
1005196969 6:23298440-23298462 CACACCAACGGGAAGAGGTGAGG - Intergenic
1007671813 6:43561321-43561343 CACAGAGATGTGAATAGGTAAGG - Intronic
1009704279 6:67225002-67225024 CACAACAACATGAAGAAGAATGG + Intergenic
1010941958 6:81929820-81929842 CTCAGTAACATGAAAAGGTAAGG - Intergenic
1011189443 6:84714407-84714429 CACAGCAATATGGAGAGATAGGG - Intronic
1016286677 6:142481380-142481402 AACAGCCAGATGAAGAGGTATGG - Intergenic
1018166247 6:161100087-161100109 CACAGCCACGTGAAGAGGTGTGG + Intronic
1019109799 6:169700827-169700849 CACAGCAGGGAGAGGAGGTAGGG - Intronic
1019791426 7:3016433-3016455 TACGGCAACGTCAAGAAGTATGG + Intronic
1023106242 7:36765668-36765690 CACAGCAACTTGGAGAGCCACGG - Intergenic
1024657218 7:51461174-51461196 CAAAGCAATGTGAACAGGTAAGG + Intergenic
1027659375 7:80970791-80970813 CACAGCAATTTGAAAAGGAAAGG + Intergenic
1027970131 7:85069914-85069936 CACAGAAAGGTAAAGAGGCATGG - Intronic
1028952579 7:96653529-96653551 CCCAGCAATGGGAAGAGGAATGG + Intronic
1033022145 7:137736470-137736492 CACAGCAACGTGAAGAGGTAAGG - Intronic
1034838480 7:154374083-154374105 CACAGCAACGTGACAGGGTTAGG - Intronic
1036497741 8:9284661-9284683 TAGAGCCACGTGAAGAGTTATGG + Intergenic
1036712239 8:11087448-11087470 CACAGCAACGTGATGAAGTTTGG + Intronic
1037390024 8:18383694-18383716 AGCAGCACCGTGAAGAGGCAAGG - Intergenic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1042600764 8:70497317-70497339 CCCAGCTACATGAAGAGCTAAGG + Intergenic
1044770998 8:95633966-95633988 TACAGCAACGTGAAGAGGCTGGG - Intergenic
1050400747 9:5251112-5251134 CACAGCAACCTGAATAGAAATGG + Intergenic
1052157568 9:25213179-25213201 AACAACAAAGTGAAGAGGAAAGG - Intergenic
1052207261 9:25857318-25857340 GAAAGTAACGTGATGAGGTAAGG - Intergenic
1055105407 9:72506920-72506942 CCTAGCTATGTGAAGAGGTATGG + Intergenic
1055148076 9:72960251-72960273 CCCAGCAACATGATGAGGTGTGG - Intronic
1055923334 9:81484915-81484937 CAAAGCAATGTGGAGAGGTAGGG + Intergenic
1058135379 9:101301913-101301935 CACAGCACTGAGAAGAGGCAAGG - Intronic
1059929202 9:119244290-119244312 CACAGCAACCTGAATAGATTTGG + Intronic
1060172238 9:121471259-121471281 TACAGCAACGTGAATAGACAGGG - Intergenic
1061342291 9:129992147-129992169 CACAGCAATGTGAAGAGGCAGGG + Intronic
1062185390 9:135215557-135215579 GACAGCAGCGTGAGGAGGAAGGG + Intergenic
1185463769 X:343819-343841 CTCAGCAACGGGAGGCGGTAGGG + Intronic
1185647933 X:1628394-1628416 CAAAGCAAAGTGAAGAGCTGAGG - Intronic
1186338427 X:8617427-8617449 CAGAGCCACGTGAAGGGGCAAGG + Intronic
1190774999 X:53545560-53545582 CACAGCAACGTTATGAGGTTAGG - Intronic
1195870995 X:109485524-109485546 CACAGCATCCCTAAGAGGTAGGG + Intergenic
1196151714 X:112381543-112381565 CAAAGCAACCTGAGAAGGTATGG + Intergenic