ID: 1033024083

View in Genome Browser
Species Human (GRCh38)
Location 7:137755752-137755774
Sequence GAGGCTAAACAAACTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033024080_1033024083 0 Left 1033024080 7:137755729-137755751 CCTGGAGGATAATGGATGAGGAA 0: 1
1: 0
2: 3
3: 20
4: 199
Right 1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 128
1033024073_1033024083 22 Left 1033024073 7:137755707-137755729 CCTATGCCCACTTCAGATACAGC 0: 2
1: 0
2: 1
3: 17
4: 153
Right 1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 128
1033024076_1033024083 15 Left 1033024076 7:137755714-137755736 CCACTTCAGATACAGCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 128
1033024072_1033024083 25 Left 1033024072 7:137755704-137755726 CCTCCTATGCCCACTTCAGATAC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 128
1033024075_1033024083 16 Left 1033024075 7:137755713-137755735 CCCACTTCAGATACAGCCTGGAG 0: 1
1: 0
2: 3
3: 17
4: 164
Right 1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033024083 Original CRISPR GAGGCTAAACAAACTGTAGG AGG Intronic
901038582 1:6350706-6350728 CAGGCTACACAAGCTGCAGGTGG - Intronic
905053981 1:35077349-35077371 TAGGCTAAACTAACTTTGGGAGG + Intronic
912582007 1:110729426-110729448 TAGGCTGAACTAACTATAGGAGG - Intergenic
913375774 1:118150565-118150587 AAGGCAAAAAAACCTGTAGGTGG - Exonic
919827946 1:201517277-201517299 GAGGCTAAACTAACTTTGGGAGG + Intergenic
920124838 1:203685718-203685740 GAGGCTGAGTAAACTGTAGAGGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922543414 1:226435828-226435850 GAGGCTAAACAACCTGCTGGAGG + Intergenic
922773519 1:228203651-228203673 GAGGCTAAACATTCTTGAGGAGG - Exonic
923702757 1:236315728-236315750 GAGGCTGAACTAACTTTGGGAGG + Intergenic
1064298110 10:14096792-14096814 GCAGCTAAACATAATGTAGGTGG - Intronic
1066207711 10:33205974-33205996 TAGGCCAAACTAACTTTAGGAGG - Intronic
1066435493 10:35393561-35393583 GAGGCAAAACGAGCTGCAGGAGG - Intronic
1066695520 10:38073971-38073993 GGAGCTTGACAAACTGTAGGTGG - Intergenic
1071057290 10:81526775-81526797 GAGTCTAAATAAAGTATAGGAGG + Intergenic
1075787368 10:125059117-125059139 GGTGCTAAACAAAGTGTGGGCGG + Intronic
1081316689 11:41638674-41638696 TAGGCTAAACTAACTTTGGGAGG + Intergenic
1084905771 11:72345761-72345783 GAGCATAAACACACTGAAGGGGG + Intronic
1085548428 11:77343568-77343590 TAGGCAAAACAAACAGTACGAGG + Intronic
1086845869 11:91748989-91749011 TAGGCCAAGCTAACTGTAGGAGG + Intergenic
1088411631 11:109540531-109540553 TAGGCTGAACTAACTTTAGGAGG + Intergenic
1088792769 11:113240879-113240901 TAGGCAAAACAAACTGTGGCTGG - Intronic
1093979650 12:25462007-25462029 GAGATTAAAAAAAGTGTAGGTGG + Intronic
1099150420 12:79105167-79105189 AACGCTAAACAAACAGGAGGTGG - Intronic
1099464670 12:82969094-82969116 GAGGCTAATCAAAATGTATTAGG - Intronic
1100345176 12:93723107-93723129 TAGGCCAAACAAAATATAGGAGG + Intronic
1101197208 12:102396431-102396453 GCTGCTAAACACACTGCAGGAGG - Intronic
1101378552 12:104192155-104192177 GAGGCTAGAAAAAATGTTGGAGG + Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1112019775 13:95361544-95361566 TAGGCCAAACTAACTTTAGGAGG + Intergenic
1118097770 14:62558027-62558049 GAGGCTAAATAAATTGCATGAGG + Intergenic
1125485390 15:40107907-40107929 CACGCTCCACAAACTGTAGGTGG + Intronic
1127506168 15:59599937-59599959 GAGGCCAAACTAACTGTAGGAGG - Intronic
1128020016 15:64381995-64382017 GAGACTAAACAAAAACTAGGGGG + Intronic
1129190796 15:73936533-73936555 GAGGATAAACAAAGTCCAGGAGG - Intronic
1129556616 15:76516799-76516821 GAGTCAAAACAAACTTAAGGAGG + Intronic
1133000208 16:2846761-2846783 TAGGCTGAACTAACTGTGGGAGG + Intergenic
1134507018 16:14816114-14816136 GAGGTTAAACAGACTGTTGTTGG + Intronic
1134573541 16:15312712-15312734 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1134728881 16:16443603-16443625 GAGGTTAAACAGACTGTTGTTGG + Intergenic
1134756597 16:16672796-16672818 GAGGCTGAATAATCTGTGGGTGG + Intergenic
1134938563 16:18268321-18268343 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1134989471 16:18686367-18686389 GAGGCTGAATAATCTGTGGGTGG - Intergenic
1142537191 17:626699-626721 GAGGCTATACACACTGTATTGGG + Intronic
1143475064 17:7197821-7197843 TAGGCTAAACAAACCACAGGAGG - Intronic
1144189632 17:12832627-12832649 TAGGCTGAACTAACTGTGGGAGG - Intronic
1144626010 17:16844823-16844845 CAGGCTCAACAAACCGCAGGGGG - Intergenic
1144794177 17:17879948-17879970 GAGGCACAACAGACTGTTGGTGG - Intronic
1150972559 17:70045302-70045324 GACAATAAACAAACAGTAGGGGG + Intergenic
1151181537 17:72332559-72332581 GAGGCTTAAAGAACTGAAGGAGG + Intergenic
1154261884 18:12842257-12842279 GAGCCTAAACAAATTGAAGGTGG + Intronic
1155859363 18:30877702-30877724 GAAGCTGAACAAAGTGGAGGAGG + Intergenic
1159490957 18:69133566-69133588 TAGGCTAAACTAACTATGGGGGG - Intergenic
1162646889 19:12056509-12056531 GCGGCTTAATAACCTGTAGGGGG - Intergenic
1164390635 19:27817238-27817260 GGGGCTAATCAGACAGTAGGGGG - Intergenic
1164785631 19:30928145-30928167 CAGGCCAAGCAAACTGTGGGAGG + Intergenic
1168438658 19:56344159-56344181 TAGGCCAAACAAACTTTGGGAGG + Intronic
927582182 2:24261579-24261601 GCAGATAAAGAAACTGTAGGAGG + Exonic
930189580 2:48443559-48443581 GATGCTAAGGAGACTGTAGGAGG + Intronic
931126717 2:59286183-59286205 GAGGATAAACCAGCAGTAGGAGG - Intergenic
931315578 2:61127872-61127894 GAAGCTCAACAAACTCTAAGAGG + Intronic
934055401 2:88247435-88247457 GAGGCTGAACAAAAAGTAGGGGG + Intergenic
936478730 2:112865401-112865423 GAGTCTACACAAACTCTGGGTGG + Intergenic
937660503 2:124425094-124425116 AATGCAAAACAAATTGTAGGAGG - Intronic
942986355 2:182146924-182146946 GAGATTAAAAAAACTCTAGGAGG + Intronic
943042666 2:182821717-182821739 TAGGCTGAACTAACTTTAGGAGG - Intergenic
946829916 2:223718116-223718138 TAGGCTGAACAAACTTTGGGAGG + Intergenic
947696664 2:232195975-232195997 TAGGCTGAACTAACTTTAGGAGG - Intronic
947925203 2:233915113-233915135 AAAACTGAACAAACTGTAGGTGG - Intergenic
948558384 2:238834031-238834053 GAGGAAAAAGAAACTGGAGGAGG + Intergenic
949029336 2:241783838-241783860 GAGGCTGAACTAACTTTGGGAGG + Intronic
1170675024 20:18471085-18471107 CAGTATAAACAAATTGTAGGTGG - Intronic
1175604427 20:60300488-60300510 CAGGATAAACAAACTGGAGGTGG + Intergenic
1185405680 22:50647994-50648016 TAGGCTGAACAAACTTTAGGAGG - Intergenic
953685557 3:45075864-45075886 GAGGTTAAACAACCTGTCTGGGG - Intergenic
955075532 3:55609629-55609651 GAGCCTACCCAAGCTGTAGGTGG - Intronic
955570120 3:60295660-60295682 GAGGCTATTCAAACTGTAGTAGG + Intronic
956578466 3:70782162-70782184 GAGGATGAATAAACTGAAGGGGG + Intergenic
958907091 3:99954087-99954109 TAGGCTAAGCAAGCTGTATGAGG + Intronic
959915557 3:111813130-111813152 AAGTATAAAAAAACTGTAGGAGG + Intronic
963873374 3:150444526-150444548 AAGGCTAAGGAAAATGTAGGTGG + Intronic
964986813 3:162752464-162752486 TAGGCCAAACTAACTCTAGGAGG + Intergenic
967138689 3:186534307-186534329 GAGGCTAAACAACTTGTCTGAGG - Intergenic
967542240 3:190680982-190681004 GAGGCTGAACCAACTTTGGGAGG - Intergenic
970084688 4:12333588-12333610 ATGTCTAAACAAACTGTAGTGGG - Intergenic
971140129 4:23916022-23916044 GAGGCTAAATAAATTGTTGGAGG - Intergenic
973030831 4:45336116-45336138 CAGGCTAGACAAATTGGAGGAGG - Intergenic
973252890 4:48079147-48079169 TAGGCTAAACTAACTTTGGGAGG + Intronic
975916491 4:79331623-79331645 GAGGCTGAACTAACTTTGGGAGG - Intergenic
976045386 4:80940474-80940496 GAGGATAAACACACTGAAGTGGG - Intronic
980195509 4:129583204-129583226 GAAACTAAACAAAGTGTAGAGGG - Intergenic
986502943 5:8419095-8419117 GTGGATAAAGAAACTGTGGGGGG + Intergenic
986509603 5:8490365-8490387 TAGGCTAAACTAACAGTAGGAGG - Intergenic
986547192 5:8910952-8910974 GAGGCTAAAGAAAATTTAGCAGG - Intergenic
994063662 5:95510292-95510314 CAGGCTAAACTAACTTTGGGAGG + Intronic
996527507 5:124494293-124494315 GAGGGGAAAAAAACTGTATGTGG + Intergenic
999528628 5:152436740-152436762 GAGGCTGAATAAACTGCAGAAGG + Intergenic
1001197804 5:169689303-169689325 GATGCTCAACAATCTGAAGGTGG + Exonic
1003852428 6:10238954-10238976 GATGGGAACCAAACTGTAGGTGG - Intergenic
1007160063 6:39783678-39783700 GAAGCTCAACAAACTCTAAGTGG - Intergenic
1007895099 6:45346929-45346951 GTGCCTAAACAAAAAGTAGGAGG + Intronic
1010201054 6:73282443-73282465 TAGGCTCAACTAACTTTAGGAGG + Intronic
1010786310 6:80004841-80004863 GCGGCTAAACGAGCTGGAGGGGG + Intronic
1010794275 6:80101262-80101284 GATGTTAAACATGCTGTAGGGGG + Intergenic
1011406840 6:87024477-87024499 GATGCTATACAAACTGTAATAGG + Intergenic
1011700254 6:89949071-89949093 GAGGCTGAATAAACTGCACGTGG + Intronic
1011774947 6:90719391-90719413 GAGGTTAAACAACTTGTAAGTGG + Intergenic
1012551585 6:100468520-100468542 GACCCTAAACAAAGTGTAGAAGG + Intergenic
1012618009 6:101301947-101301969 TAGGCTAGACCAACTATAGGAGG + Intergenic
1016163984 6:140917095-140917117 TAGGCCAAACTAACTGTGGGAGG + Intergenic
1017045785 6:150346083-150346105 AAGGCCAAACAGCCTGTAGGTGG + Intergenic
1019782441 7:2951436-2951458 GAGGCCAAACTAACTTTGGGAGG + Intronic
1022757581 7:33310149-33310171 AAGATTAAACACACTGTAGGAGG - Intronic
1031233458 7:119141377-119141399 GATGCTAAAGAAACTGTACTAGG - Intergenic
1032207341 7:129879083-129879105 GGGGCTAAAGAGACTGGAGGTGG + Intronic
1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG + Intronic
1037777657 8:21846493-21846515 GAGGCTAAAGAAGCTGCAGTCGG + Intergenic
1038090396 8:24246903-24246925 CAGGCTAAACTAACTTTGGGAGG + Intergenic
1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG + Intronic
1040582063 8:48706220-48706242 TAGGCCACACAAACTGTATGTGG - Intergenic
1040635205 8:49265187-49265209 GTGGATAAAGAAACTGTGGGGGG - Intergenic
1043505865 8:80901510-80901532 GAAGCTAAATGAACTGTAAGTGG + Intergenic
1043613071 8:82090545-82090567 GAGGCTGAAAAATCTGTAGCAGG + Intergenic
1043613366 8:82093345-82093367 GAGGCTGAAAAATCTGTAGCAGG + Intergenic
1044335876 8:90984881-90984903 GAGGGGAAAGAAAGTGTAGGGGG - Intronic
1050324228 9:4484717-4484739 TAGGCCAAACTAACTTTAGGAGG + Intergenic
1051630955 9:19140549-19140571 TAGGCTGAACTAACTTTAGGAGG + Intronic
1057318478 9:93989294-93989316 TAGGCTGAACTAACTTTAGGAGG + Intergenic
1059230048 9:112712051-112712073 GAGGCTAACCAAGCTGTTAGTGG - Intronic
1059813280 9:117881640-117881662 GAGGCTAAAGAAGCTGGAGTGGG + Intergenic
1189631645 X:42960581-42960603 TAGGCTGAACTAACTGTGGGAGG - Intergenic
1189789555 X:44590475-44590497 TAGGCTGAACTAACTGTGGGAGG + Intergenic
1191752727 X:64560705-64560727 GAGGCAAGACAGAGTGTAGGAGG - Intergenic
1192777097 X:74256399-74256421 TAGGCTAAACCAACTTTGGGAGG - Intergenic
1194370889 X:93070093-93070115 GAGGCTATACAATCAGCAGGTGG - Intergenic
1194718359 X:97312159-97312181 TAGGCTGAACTAACTTTAGGAGG - Intronic
1195959481 X:110370879-110370901 GAGTATCAACAAACTGTACGAGG - Intronic
1196805523 X:119581554-119581576 GAGACAAATCTAACTGTAGGTGG - Exonic
1197111065 X:122775584-122775606 AAGGCTGAACTAACTTTAGGAGG + Intergenic
1200678685 Y:6181981-6182003 GAGGCTATACAATCAGCAGGTGG - Intergenic