ID: 1033030908

View in Genome Browser
Species Human (GRCh38)
Location 7:137825473-137825495
Sequence CAACAGCCATGATGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033030908 Original CRISPR CAACAGCCATGATGGGAAAT AGG Intronic
901853074 1:12028432-12028454 GAACAGCCAGGAGGGGAAAGTGG - Intronic
902185269 1:14720246-14720268 CAACAGCAAGGAAGGGGAATGGG - Intronic
902576011 1:17378068-17378090 TAAGAGCCATTAGGGGAAATAGG - Intronic
903795733 1:25927632-25927654 AAACAGCCATGATGGGGGAGGGG - Intergenic
904578567 1:31522811-31522833 CAGCTGCCATGATAGGAAAGGGG - Intergenic
905628971 1:39508295-39508317 CAGCAGCCATGGTGGGGAAAGGG - Intronic
905943683 1:41884421-41884443 CAGCAGCCATGATGGCATTTCGG - Intronic
906927012 1:50128629-50128651 TAAGAGCCATGATGGGGGATTGG + Intronic
908398203 1:63745665-63745687 GAGGAGCCATGATGGGAATTGGG - Intergenic
909547856 1:76867875-76867897 CCAGAGCCAGGATGGGAACTCGG + Intronic
909784822 1:79597987-79598009 CAATAGCCATGATGTGGAAATGG + Intergenic
909799914 1:79793960-79793982 CAATAGCCAAGATATGAAATTGG - Intergenic
913128415 1:115814857-115814879 CAACAGACAAGGTGGGAAAAAGG - Intergenic
913283649 1:117208671-117208693 CAACAGCCATGATGGGGAGAGGG + Intronic
915314871 1:155022815-155022837 CAACAGCCAATTTGGGAAAAGGG - Intronic
915613202 1:157012744-157012766 CAACAGCAATGCTGTGAAGTAGG - Intronic
916466055 1:165075649-165075671 CAACATCCCTGGTGGGGAATGGG - Intergenic
918538531 1:185602531-185602553 CAACAGCCATTCTGGGAAGCTGG + Intergenic
921364645 1:214362238-214362260 CAATAGCAACCATGGGAAATAGG + Intronic
924706544 1:246507167-246507189 CAACCGCCAAGAGGGGAAACGGG - Exonic
1063538655 10:6910275-6910297 TGACAGCAATGATGGGAAAATGG - Intergenic
1064109403 10:12525067-12525089 CATCATTCATGATGAGAAATTGG + Intronic
1068918329 10:62457424-62457446 CTACACCCATGATGGAATATGGG - Intronic
1069229244 10:65987587-65987609 GTACAGCCATTATGGAAAATAGG + Intronic
1070707770 10:78653803-78653825 CAATAGCCATGATGTGACACAGG + Intergenic
1070783467 10:79150286-79150308 CAGCAGCTCTCATGGGAAATAGG - Intronic
1072826527 10:98612159-98612181 AAACAGGCATGTTGAGAAATTGG - Intronic
1073448408 10:103594615-103594637 CAAGACACAGGATGGGAAATGGG - Exonic
1074849873 10:117431120-117431142 CAAGAGCCAGGAGGAGAAATGGG - Intergenic
1074971731 10:118544598-118544620 CAACAGCCAAGGTGGGAAGCTGG + Intergenic
1075223724 10:120606485-120606507 TAAAAGCCATGATTAGAAATTGG + Intergenic
1075426880 10:122348945-122348967 CAACAGCCAGGAAAAGAAATGGG - Intergenic
1075528877 10:123210201-123210223 AACCAGCCATGATGGAAACTGGG - Intergenic
1076385113 10:130050066-130050088 CATCAGCCATAATGGAAAAACGG + Intergenic
1076866320 10:133168069-133168091 TAACGGTTATGATGGGAAATGGG - Intronic
1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG + Intronic
1082795315 11:57374720-57374742 CAACTGCCATGGATGGAAATTGG - Intergenic
1085562318 11:77483348-77483370 GAATAGACATGCTGGGAAATGGG + Intergenic
1089766652 11:120772512-120772534 TAAGAGCCAGGATGGGAATTAGG + Intronic
1092570265 12:9713856-9713878 CAAGAGCCATGTTTGGAAATTGG - Intergenic
1095329427 12:40940128-40940150 AGAAAGCCAGGATGGGAAATGGG + Intronic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1100367180 12:93932607-93932629 TTCCAGCCATGATGGGAAGTCGG + Intergenic
1102560784 12:113760879-113760901 TGAGAACCATGATGGGAAATGGG - Intergenic
1106089651 13:26578855-26578877 CAACAGTCATGAATGGATATTGG + Intronic
1108959992 13:56214801-56214823 CCTCAGCCATGATGTGAGATGGG + Intergenic
1110110493 13:71738947-71738969 CAACAACTATTATGAGAAATTGG + Intronic
1110630705 13:77703326-77703348 CAACAGCTTTGATGAAAAATTGG - Intronic
1112184725 13:97116573-97116595 CAGCAGCCTGGTTGGGAAATTGG + Intergenic
1113304830 13:109066094-109066116 ACACAGCCATGATGTTAAATTGG + Intronic
1115509756 14:34128012-34128034 CACCAGCCTTGATGAGAGATGGG - Intronic
1118419524 14:65585701-65585723 CAACAGTGAAGATTGGAAATTGG + Intronic
1120951329 14:90044860-90044882 CAACAGCCATGAAAGGAAACAGG + Intergenic
1122737284 14:103849992-103850014 CACCAGTAATGATGGGATATAGG + Intergenic
1124071388 15:26396317-26396339 CAACAGCCAGAATGGGGAAGTGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126412368 15:48385556-48385578 AAACAGTCCTGATGGGAAATGGG - Intergenic
1126710316 15:51447637-51447659 CAAAAGCCATTCTAGGAAATGGG - Intergenic
1127510952 15:59640570-59640592 CAACAGCCATGAGTGGCTATTGG + Intronic
1127665435 15:61141677-61141699 GAACAGCCAGAATGAGAAATGGG + Intronic
1128819423 15:70638466-70638488 GAACAGCCATGCTAAGAAATGGG + Intergenic
1130675176 15:85946094-85946116 CAAAAGCCATGGTGGGTAAGTGG - Intergenic
1131051290 15:89349720-89349742 CACCAGCCAAGGTGGGACATGGG + Intergenic
1131693843 15:94855205-94855227 GAGCAGCCATGGTGGGAAAGAGG - Intergenic
1133106795 16:3516443-3516465 CCACAGCCCTGGTGGGAGATTGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1137741952 16:50786160-50786182 AAACAGCCACCAAGGGAAATGGG - Intronic
1138488773 16:57363940-57363962 CAACATTCATGAAGGGAAGTGGG - Exonic
1139476254 16:67203915-67203937 CAGCAGCCATGAAGGGCAGTGGG + Exonic
1140912248 16:79464851-79464873 CACAAGCCATGGTGGGAAACAGG - Intergenic
1142906868 17:3049330-3049352 CAACAGCCCTCAGGGGAAAATGG + Intergenic
1143291200 17:5830545-5830567 AAACAACCAAGATGGGAAGTGGG + Intronic
1144702422 17:17348206-17348228 CAAGGGCCATGATGGGAGAGCGG - Intergenic
1150495127 17:65601934-65601956 CAAAAGTCAAAATGGGAAATTGG - Intronic
1151329792 17:73400023-73400045 TTACAGCCATGCTGGCAAATAGG - Intronic
1151512806 17:74571611-74571633 AAACTGTCATGATGGGAAGTGGG + Intergenic
1152011854 17:77723809-77723831 GAACAGCCAGGCTGGCAAATCGG + Intergenic
1155095524 18:22551557-22551579 CAACAGTCATGGTGTGACATTGG + Intergenic
1155580968 18:27306007-27306029 AGACAGCAGTGATGGGAAATTGG - Intergenic
1157533258 18:48440047-48440069 CAAGCTCCATGATGGGAAGTGGG - Intergenic
1159187990 18:65003329-65003351 CAACAGGAATTATGGGGAATAGG + Intergenic
1160442897 18:78906063-78906085 CTACAGCCATTGTGGGAAAGAGG + Intergenic
1161628720 19:5340700-5340722 CAACAGCCACGATGTGAAGCGGG - Exonic
1161778361 19:6276112-6276134 CAACGGGCATAAAGGGAAATGGG + Intronic
1163181857 19:15609593-15609615 AAACAACCAGGATGGGAAATGGG - Intergenic
1163313081 19:16525593-16525615 CAACAGCCATGAGGGCATGTGGG - Exonic
926914200 2:17877807-17877829 TAACAGCCAGGAGGAGAAATGGG - Intergenic
927927585 2:27024514-27024536 CACCAGCCATGGTGGCAACTGGG + Intronic
928613117 2:33010096-33010118 CAGCAGCCATGGGGGGACATGGG + Intronic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
929916924 2:46144004-46144026 CAACAGCCATGCTGGGATGCAGG - Intronic
930292810 2:49517190-49517212 TAAGTGCCAGGATGGGAAATGGG - Intergenic
931689016 2:64819476-64819498 GAACAGTCATGGTGGGAAAATGG + Intergenic
932003444 2:67905605-67905627 AAACAGGCAGAATGGGAAATAGG + Intergenic
932929382 2:76015798-76015820 CAAAAGCCATCATGAGAAATTGG - Intergenic
932994099 2:76827791-76827813 AATCAGACATGATGGGAAAGAGG - Intronic
933449266 2:82425492-82425514 CAGCAGCCATGCTGAGAACTTGG - Intergenic
934525806 2:95050814-95050836 AACCAGCCATGTTGGGAGATGGG - Intronic
935461932 2:103347062-103347084 CTACAGCCATGGAAGGAAATGGG - Intergenic
936403749 2:112184865-112184887 TAACAGCCATGGAGGGTAATGGG + Intronic
936830452 2:116639042-116639064 GTACAGCCATTATGGAAAATAGG + Intergenic
939330354 2:140751457-140751479 CAAAAGCCATGATAGAAAATTGG - Intronic
941873770 2:170412717-170412739 CAACAGCCATAAGTGGAAAATGG - Intronic
942191068 2:173470795-173470817 GAACAGACAGAATGGGAAATTGG + Intergenic
943342339 2:186695337-186695359 CTACAGCCATGAAGCGAAGTGGG - Intronic
943566032 2:189517828-189517850 CAAGAGCCCTGATGGAGAATGGG + Intergenic
945322286 2:208438501-208438523 AAACAGCACTGATGTGAAATTGG - Intronic
945798448 2:214393705-214393727 CAACACTCATAATGTGAAATTGG + Intronic
947160002 2:227204951-227204973 CAACAGCGGTGATGGAAAACAGG + Intronic
947480398 2:230494263-230494285 CAACAACCAAGATGGGATGTTGG + Intronic
948150890 2:235743920-235743942 CAACAGCCATCTTGGAAAACTGG - Intronic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1173826386 20:46050482-46050504 CCACAGCCCTGATGGGAGAAAGG - Intronic
1173871196 20:46343312-46343334 GCACAGTCAGGATGGGAAATTGG + Intergenic
1173946010 20:46951563-46951585 CAACAGCCCTGAAGGGCAACCGG + Intronic
1178960606 21:37061271-37061293 GAACAGACTTGATGGGACATGGG - Intronic
1179965574 21:44802578-44802600 CTACAGCCATTATGGGAAAAAGG - Intergenic
1181545636 22:23600568-23600590 CACCAGCCCAGCTGGGAAATGGG - Intergenic
1181814674 22:25429331-25429353 CACCAGCCCAGCTGGGAAATGGG + Intergenic
1183022045 22:35035057-35035079 CAAGAGCCATGGAGGGAACTGGG + Intergenic
1185135071 22:49065556-49065578 AAACAGCCAACATAGGAAATTGG + Intergenic
951584612 3:24202965-24202987 CAACTGGCCTGATGGCAAATGGG + Intronic
951833170 3:26952493-26952515 TTGAAGCCATGATGGGAAATGGG - Intergenic
951938505 3:28051235-28051257 CAACTGCCATGGAGGGGAATGGG - Intergenic
953571775 3:44076762-44076784 GAGCAGCCAAGATGGGAAAGGGG + Intergenic
954187412 3:48928511-48928533 CACTGGCCATTATGGGAAATTGG + Intronic
955471189 3:59288043-59288065 CAGCAGCCATGAAGGGAGTTTGG - Intergenic
956505788 3:69938174-69938196 CCACAGCCACGATGGTGAATCGG - Intronic
957608142 3:82431109-82431131 CATCAGCCAAGATGGCAAATTGG + Intergenic
958063297 3:88510546-88510568 CTACAGTCATATTGGGAAATTGG - Intergenic
958896034 3:99830478-99830500 CCACAGCCATTTTGGTAAATAGG + Intronic
963350815 3:144148895-144148917 CAACAGCCATAGTGTGAAACAGG - Intergenic
965391742 3:168112631-168112653 CAAAAGCCATGATGTATAATTGG - Intergenic
965441699 3:168722784-168722806 CAAGAACCATGTTGTGAAATAGG - Intergenic
966982483 3:185151465-185151487 CAACAGGAATAATGAGAAATAGG + Intronic
967097849 3:186192349-186192371 CTACAGCCAAGATGGGGAAGTGG - Intronic
967138876 3:186536275-186536297 CTACAGCCAAGATTGGAAACTGG + Intergenic
968270462 3:197399506-197399528 GAATAGCCACGGTGGGAAATGGG - Intergenic
970391528 4:15616931-15616953 CAATAGCCATCTTGGGAAAGAGG - Intronic
971455177 4:26837269-26837291 CAAGTGCCATAATGGGAGATGGG + Intergenic
972617944 4:40718381-40718403 CAGTAGCCAGGATGGGAATTGGG + Intergenic
973717329 4:53690225-53690247 CAATAGCCATGTTGGCAAAGTGG - Intronic
975974761 4:80081987-80082009 CAACAGTGGTGATGAGAAATTGG + Intronic
977349252 4:95859920-95859942 CAAAAGCAATGATGGTAAAATGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
979648003 4:123094326-123094348 TTCAAGCCATGATGGGAAATAGG - Intronic
979868203 4:125782193-125782215 CAACATTCATGATGGGAACCTGG - Intergenic
981423082 4:144573450-144573472 CAACAACCATTATGGGAAAAAGG + Intergenic
982263172 4:153513648-153513670 CTACAGACCAGATGGGAAATGGG - Intronic
982452986 4:155574175-155574197 CAAAAGCCAAGCTGGCAAATGGG + Intergenic
982821861 4:159950879-159950901 CAACAGCCATGCTGGGTTTTTGG - Intergenic
983386710 4:167072263-167072285 CAGCAGCCATGATGGCCTATGGG + Intronic
984585120 4:181554618-181554640 TAACATCCATGAGGTGAAATGGG - Intergenic
986643157 5:9891756-9891778 CAACTGCCCTGATGGGTACTGGG - Intergenic
987056501 5:14198543-14198565 GAACTGCAATGATGGGAATTTGG + Intronic
990782391 5:59379979-59380001 CAAAAGCCAGGAGGGGAAAGGGG - Intronic
991553949 5:67874374-67874396 GAACAGGCAGGATAGGAAATGGG - Intergenic
991586305 5:68205690-68205712 CAAGACCCATGATGGGAAGCTGG + Intergenic
992636685 5:78731369-78731391 CAAAAGCCTTGATGGGTAAAAGG + Intronic
995938655 5:117550904-117550926 CATCAGACATTATGGGAAATTGG - Intergenic
995956518 5:117783265-117783287 AAACATACATCATGGGAAATGGG - Intergenic
996523257 5:124450558-124450580 AAACAGCCATCTTGGGAAGTGGG - Intergenic
998959123 5:147466177-147466199 CAACAGACATTATGGCTAATTGG - Intronic
1001349899 5:170950648-170950670 AAACAGCCATTATGGAAAATAGG + Intronic
1001762645 5:174221036-174221058 CAGCAGCCATGACTGGAAGTAGG - Intronic
1003360062 6:5416880-5416902 CAAAGGCCAAGATGGGAAACAGG - Intronic
1004146371 6:13070708-13070730 CAACAGAAACGATTGGAAATAGG + Intronic
1004423099 6:15488867-15488889 CAACAGCCACGGTGTGGAATTGG + Intronic
1005454019 6:26001416-26001438 CAAGAGCCAATGTGGGAAATGGG - Intergenic
1006327136 6:33362876-33362898 CAGCAGCCATGCAGGGTAATGGG - Intergenic
1007182649 6:39941540-39941562 CAAGAGCAATAATGGGAAGTAGG + Intergenic
1007512969 6:42388708-42388730 AAACAGCCATGAGAGGCAATCGG + Intronic
1008409094 6:51152423-51152445 CAACAGCCCTGACTGGACATCGG + Intergenic
1009941154 6:70289416-70289438 CAGAAGCCATGATTGGAAGTAGG - Intronic
1010258144 6:73784200-73784222 CAAAAGACATGATGGAATATTGG - Intronic
1013301636 6:108809651-108809673 CAAGATCCCAGATGGGAAATGGG + Intergenic
1016577247 6:145583653-145583675 CAGCAGCCATGGTGGCAAAGTGG + Intronic
1017313222 6:152999386-152999408 AAACAACCATGCTGGGAAGTGGG + Intronic
1018391416 6:163344564-163344586 CCAAAGCCAGGTTGGGAAATAGG + Intergenic
1020430695 7:8113648-8113670 CAGCAGCCATGATGGGATGTAGG + Exonic
1020575521 7:9922354-9922376 CAACAGCCATGCTAAGAAATAGG - Intergenic
1023191728 7:37590214-37590236 CTACAGCCATGATGATTAATTGG + Intergenic
1027907469 7:84204344-84204366 TGACAGCCATGATGGGAAAAGGG - Intronic
1029238429 7:99142810-99142832 CAAGAGAGATGATGGGAAAGTGG + Intronic
1030309853 7:108058203-108058225 CAAAACACATAATGGGAAATGGG + Intronic
1031424501 7:121588891-121588913 CTCAAGCCATGATGGGAAAGAGG + Intergenic
1032120311 7:129150440-129150462 CATCAGCCATCATGGGAGATGGG - Intronic
1033030908 7:137825473-137825495 CAACAGCCATGATGGGAAATAGG + Intronic
1033298558 7:140163971-140163993 CAACTGCCATGAATGGATATTGG + Intronic
1033313829 7:140281884-140281906 TAAGAGGCATGATGGGAAAGCGG - Intergenic
1033601707 7:142893356-142893378 TAACAGCCATGATGGGCTTTGGG - Intergenic
1035549276 8:507724-507746 CAACAGCAACAATGGGAAAGGGG + Intronic
1035920894 8:3675123-3675145 CTTGAGCCATGATGGGAAAGTGG - Intronic
1036703415 8:11029193-11029215 CAACAGCCCAGAAGGAAAATTGG - Intronic
1037958696 8:23079667-23079689 AAACAGCCATGAAAAGAAATAGG - Intergenic
1039079388 8:33720824-33720846 AAAAAGCTATGATGGGAACTAGG + Intergenic
1039799409 8:40941404-40941426 AAACAGCCATGATGGAAAGTGGG - Intergenic
1041390089 8:57340000-57340022 CAGCAGCCACGATGGAAAAGTGG + Intergenic
1041501555 8:58544255-58544277 AAATAGCCATGTTGGGAAAAAGG - Intergenic
1043104367 8:76089661-76089683 CACCAGCTATGATGGTAAAGGGG + Intergenic
1045537664 8:103047515-103047537 CAACAGCTAGGAGGGGAAACTGG - Intronic
1047607691 8:126491168-126491190 CAATATCTGTGATGGGAAATAGG + Intergenic
1048199395 8:132359323-132359345 CACCAACAATGCTGGGAAATTGG - Intronic
1048619683 8:136118194-136118216 CAACCCCCATGATGGGAAGAAGG + Intergenic
1050172140 9:2831951-2831973 CAACAGTCATGAGGAGGAATGGG - Intronic
1052278980 9:26711267-26711289 ACACAGCAATGATGAGAAATTGG - Intergenic
1055641757 9:78324307-78324329 CAACAGGCATTCTGGGAAAGTGG - Intronic
1057544611 9:96008195-96008217 CAAGAGCCATGTTGGGACACTGG + Intronic
1059547909 9:115197324-115197346 CTACAGCCATGTAGGGAGATGGG - Intronic
1059605782 9:115833498-115833520 GAAGAGCCATAATGGGAAACTGG - Intergenic
1059719642 9:116946866-116946888 CAACCTCCATAATGGGAATTGGG + Intronic
1060668423 9:125447513-125447535 CAGCAGCCATGCTGGGCCATAGG + Intronic
1062387128 9:136317100-136317122 CCACAGCAGGGATGGGAAATGGG + Intergenic
1186734962 X:12452495-12452517 TTACTGCCATGTTGGGAAATTGG - Intronic
1186956562 X:14688507-14688529 CAGCAGCGAGGATGGGGAATGGG - Intronic
1187044692 X:15635160-15635182 TTTCAGCCTTGATGGGAAATTGG + Intronic
1191648623 X:63510915-63510937 CAACAGAAATGATGGAATATAGG - Intergenic
1194485950 X:94486375-94486397 TTCAAGCCATGATGGGAAATGGG - Intergenic
1195974758 X:110514471-110514493 AATCAGACATGATGGAAAATTGG - Intergenic
1196398333 X:115289401-115289423 CAACAGCAAAGAGGAGAAATGGG + Intergenic
1197320601 X:125024936-125024958 CAACAGAATTGATTGGAAATTGG - Intergenic
1200700308 Y:6396508-6396530 CAACAGCAATGATGTCAGATAGG - Intergenic
1201033803 Y:9768190-9768212 CAACAGCAATGATGTCAGATAGG + Intergenic
1201255868 Y:12107775-12107797 CTACAGCCATGGTGGGAAACAGG - Intergenic
1201630685 Y:16068943-16068965 CAACAGCCTTCATGGGAGACTGG - Intergenic