ID: 1033031222

View in Genome Browser
Species Human (GRCh38)
Location 7:137829061-137829083
Sequence TAAAATAGTTCAGCTTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033031222_1033031225 -5 Left 1033031222 7:137829061-137829083 CCACCACAAGCTGAACTATTTTA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1033031225 7:137829079-137829101 TTTTAGATGGCAAAACAGCTAGG 0: 1
1: 1
2: 0
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033031222 Original CRISPR TAAAATAGTTCAGCTTGTGG TGG (reversed) Intronic
900010829 1:106282-106304 TAAGATAGTTCAGCTGTTTGGGG + Intergenic
900026931 1:282846-282868 TAAGATAGTTCAGCTGTTTGGGG + Intergenic
902208873 1:14890462-14890484 TAAAAATGTTCAGCTTTTAGGGG - Intronic
911559447 1:99385994-99386016 TAAAAAAGTTGATCTTATGGAGG + Intergenic
911731331 1:101294997-101295019 AAAAAGAGTTTACCTTGTGGAGG + Intergenic
911768889 1:101713931-101713953 TCAAATGGATCAGATTGTGGAGG + Intergenic
912942293 1:114056066-114056088 TAACATAGGCCAGTTTGTGGAGG - Intergenic
913941636 1:125114606-125114628 AAAAATAATTCAAATTGTGGTGG - Intergenic
915754317 1:158244270-158244292 TAAAACAATTAAGCTTATGGAGG + Intergenic
916106814 1:161439173-161439195 ACAAAAAGTTCACCTTGTGGAGG + Intergenic
916108257 1:161446225-161446247 TCAAAATGTTCACCTTGTGGAGG + Intergenic
916109843 1:161453605-161453627 TCAAAATGTTCACCTTGTGGAGG + Intergenic
916111430 1:161461016-161461038 TCAAAATGTTCACCTTGTGGAGG + Intergenic
916113016 1:161468396-161468418 TCAAAATGTTCACCTTGTGGAGG + Intergenic
916116822 1:161492033-161492055 TCAAAAAGTTCACCTTGTTGAGG - Intergenic
918767762 1:188510983-188511005 AAAACTAGTTCAGCTCATGGTGG + Intergenic
919173916 1:193995025-193995047 TAAAACAGTTGATCTCGTGGAGG + Intergenic
919304986 1:195820853-195820875 TAAATTAGTTCAGCTACTAGGGG + Intergenic
919424292 1:197410200-197410222 TCAAATATTTCAGCTTGCAGTGG - Intronic
921611851 1:217221817-217221839 TTATATAGTTCATCTTCTGGAGG + Intergenic
921869968 1:220129554-220129576 TAAAAAAGTTGATCTTATGGAGG - Intronic
922259276 1:223922289-223922311 TAAGATAGTTCAGCTGTTTGGGG + Intergenic
923471785 1:234297580-234297602 TAAAATAGTTAAGCTTGGGCCGG + Intronic
924340459 1:243025036-243025058 TAAGATAGTTCAGCTGTTTGGGG + Intergenic
1064615320 10:17147898-17147920 TAAAATGGTTCAGCTGCTGTTGG - Exonic
1064976671 10:21124391-21124413 TATAATGGTTCAGCAAGTGGAGG - Intronic
1065433614 10:25684517-25684539 TAAAATATCTCAGCTTTTGCAGG + Intergenic
1066736040 10:38480564-38480586 TAAGATAGTTCAGCTGTTTGGGG - Intergenic
1068494700 10:57772639-57772661 TAAATTAGTTCAGCTACTGTGGG + Intergenic
1068778487 10:60893299-60893321 AGAAATAGTTCAGCATGTTGTGG - Intronic
1068825948 10:61439226-61439248 TAAAACAGTACAGCATGTGTTGG - Intronic
1073624248 10:105080142-105080164 TAAATTAGTTCAGCTGCTGTGGG - Intronic
1073681650 10:105711089-105711111 TAAAATATTTTTGCTGGTGGAGG - Intergenic
1073885186 10:108030811-108030833 TAAAATAGTACAGCTTCTGTGGG + Intergenic
1074495502 10:113976785-113976807 TAGAATTGGTCAGCTAGTGGTGG + Intergenic
1075481513 10:122786527-122786549 TAAAATGGGCCAGCTCGTGGAGG - Intergenic
1077350291 11:2090107-2090129 AAAAATAATTCAGCTAGGGGAGG + Intergenic
1078044095 11:7897390-7897412 TCACATTGTTCAACTTGTGGTGG + Intergenic
1078955687 11:16191966-16191988 TAAAATACTTCAGCTGGAGCAGG - Intronic
1081294064 11:41363778-41363800 TAAAATAGTTTTGCTGTTGGCGG - Intronic
1085578846 11:77632226-77632248 TAAAATAATACAGCTTTTGTAGG - Intronic
1086497217 11:87416880-87416902 TAAAATAGTTGATCTCATGGAGG + Intergenic
1087445451 11:98245550-98245572 TAAAAAAGTTGATCTTATGGAGG - Intergenic
1088780441 11:113128885-113128907 TAAAATACTTCAAGTTGTGAGGG + Intronic
1093636409 12:21475576-21475598 TAAAATATTTCAGGTAGTAGTGG - Exonic
1093713037 12:22349646-22349668 TAAAATTGTTGAGTTAGTGGAGG + Intronic
1094251118 12:28363012-28363034 TTAAATATTTCAGCTTATGCAGG - Intronic
1095620033 12:44241889-44241911 TAAAATATTTTAACATGTGGAGG + Intronic
1098032184 12:66266365-66266387 TAAAATAGTTGATCTCATGGAGG - Intergenic
1098054037 12:66484618-66484640 TAAAAAAGTTGATCTCGTGGAGG + Intronic
1099748847 12:86744836-86744858 TAAAATTGTTCATACTGTGGTGG - Intronic
1102704813 12:114871748-114871770 TCATATAGCTCAGCTGGTGGGGG + Intergenic
1103004627 12:117411083-117411105 TAAAAAAGTTGATCTTGTGGAGG - Intronic
1107616020 13:42169131-42169153 GAAAATAGTTCATTTTGTGGGGG + Intronic
1107953690 13:45488167-45488189 TAAAAAAGTTGGTCTTGTGGAGG + Intronic
1110045875 13:70829798-70829820 TAAAATAGTATATCCTGTGGTGG + Intergenic
1113448589 13:110389256-110389278 TAAAGTAGTGCATCATGTGGAGG + Intronic
1113448594 13:110389316-110389338 TAAAGTAGTGCATCATGTGGAGG + Intronic
1114839801 14:26249735-26249757 TAAAATTGTACAGCTTGGGTTGG + Intergenic
1116377215 14:44218167-44218189 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
1116978841 14:51146328-51146350 TAGAAAAGTTCAGTTTGTAGAGG + Intergenic
1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG + Intergenic
1123607522 15:22049386-22049408 TAAATTAGTTCAGCCTCTGTGGG + Intergenic
1129347745 15:74934701-74934723 AAAAAAAGTTAAGCATGTGGGGG - Intronic
1202979757 15_KI270727v1_random:341165-341187 TAAATTAGTTCAGCCTCTGTGGG + Intergenic
1132661768 16:1064766-1064788 TGAAATAGTTCAGCCGGTGCAGG - Intergenic
1138086347 16:54137093-54137115 TAAAAAAGTTGATCTCGTGGAGG - Intergenic
1138517488 16:57544332-57544354 TGAAATGGCTCAGCGTGTGGGGG + Intronic
1139791293 16:69438477-69438499 TAAAATAGTGCAGCTGCTGTGGG - Intronic
1142453518 16:90200634-90200656 TAAGATAGTTCAGCTGTTTGGGG - Intergenic
1142779760 17:2172385-2172407 TTAAATAGTGCAGCTTGTGTTGG - Intronic
1142845496 17:2672112-2672134 TAAAATAGTTGTGGGTGTGGTGG + Intronic
1144486217 17:15666618-15666640 TAAATTAGTTTTGCTTGTGCTGG + Intronic
1144914802 17:18715674-18715696 TAAATTAGTTTTGCTTGTGCTGG - Intronic
1145326780 17:21838285-21838307 AAAAATAATTCAACTTGTGGTGG - Intergenic
1145689756 17:26727482-26727504 AAAAATAATTCAACTTGTTGTGG - Intergenic
1149953082 17:61012948-61012970 TAAAATATTTCAGTTTTAGGAGG - Intronic
1152117268 17:78396198-78396220 TAGGATAGTTCAGCTTGGAGTGG + Intronic
1158475093 18:57772913-57772935 TAAAACAGTTCATGTTGTTGAGG - Intronic
1158637318 18:59171946-59171968 TAAAAAAATTGATCTTGTGGAGG + Intergenic
1163540590 19:17907149-17907171 AAAAATAGTGCAGGGTGTGGTGG - Intergenic
1165180991 19:33968969-33968991 TAAAAAAGTTGAGCTCATGGAGG - Intergenic
1167597228 19:50434204-50434226 TAAATTAGCTGGGCTTGTGGGGG + Intronic
1202669203 1_KI270709v1_random:35328-35350 AAAAATAATTCAAATTGTGGTGG - Intergenic
926469406 2:13235370-13235392 TAAAATATTTTCGCATGTGGAGG + Intergenic
928739901 2:34338890-34338912 TAAAATATTTCAGCTTCTTAGGG + Intergenic
930294559 2:49538383-49538405 TAAAATGGTTCATCTTGTATTGG + Intergenic
930337030 2:50061006-50061028 TAAAATAGTTCAGAATGTTTAGG + Intronic
930343073 2:50142246-50142268 TAAAAAAGTTGATCTTATGGAGG + Intronic
931071365 2:58654492-58654514 TTAGATATTTCAGTTTGTGGAGG + Intergenic
933521810 2:83383359-83383381 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
934252093 2:90364537-90364559 AAAAATAATTCAACTTGTCGTGG + Intergenic
934257350 2:91438409-91438431 AAAAATAATTCAACTTGTCGTGG - Intergenic
934874330 2:97901722-97901744 TAAAAAAGTTTATCTTGTGAAGG + Intronic
935686218 2:105686118-105686140 TAAAAAAGTTGATCTTATGGTGG + Intergenic
935892856 2:107698583-107698605 TGCAATCCTTCAGCTTGTGGTGG + Intergenic
936773211 2:115939859-115939881 TAAATTAGTTCAGATTTTTGAGG - Intergenic
936940962 2:117883556-117883578 TAAATTAGTTAAGATTTTGGAGG + Intergenic
938710991 2:133976175-133976197 TAATCTAGTTGAGCATGTGGAGG + Intergenic
939185431 2:138855249-138855271 AAACATAATTCAGCTTTTGGTGG - Intergenic
940681768 2:156794762-156794784 TAAAATACTTCATATTGTGTGGG + Intergenic
941874757 2:170421206-170421228 TAAAATAGATCTGATTCTGGTGG - Intronic
943410590 2:187541992-187542014 TAAAATATTTTAGCGTGAGGGGG + Intronic
944661572 2:201925966-201925988 TAAAATAATCTAGCTAGTGGGGG + Intergenic
945712783 2:213320613-213320635 TAAAATAGTTGATCTCATGGAGG - Intronic
948717972 2:239877879-239877901 AAAATTAGTTCAGGCTGTGGTGG - Intergenic
949084960 2:242145283-242145305 TAAGATAGTTCAGCTGTTTGGGG - Intergenic
1169883014 20:10367884-10367906 TAAACTTGTTCAGCTGCTGGAGG + Intergenic
1170064513 20:12296128-12296150 TAAAAAAGTTGATCTTATGGAGG - Intergenic
1170801952 20:19597771-19597793 TAAAATAGTTAATCTCATGGAGG - Intronic
1171244317 20:23598323-23598345 TCAAATGGTCCAGCTAGTGGTGG + Intergenic
1172088029 20:32404211-32404233 TAAAAGAGTTGATCTCGTGGAGG - Intronic
1173369769 20:42425023-42425045 TAAAATAGGACAGGTTGAGGGGG + Intronic
1174309076 20:49636392-49636414 CAAAGTAGTTCAGGTTGTTGAGG + Exonic
1175539247 20:59738017-59738039 TAAAATAGTGCAGGTAGTGACGG + Intronic
1175757990 20:61541992-61542014 TTAAATGGTTCGGCATGTGGTGG - Intronic
1177411710 21:20738471-20738493 TAAAATAGTGGTGCTTGTTGAGG - Intergenic
1180687879 22:17684543-17684565 TAGAATAGTTCACTATGTGGTGG + Intronic
1180963613 22:19774158-19774180 TAAGATAGTGCAGCTTCTGTGGG + Intronic
1181732919 22:24860397-24860419 TCAAATATTTTAGCTTGAGGAGG + Intronic
1183123301 22:35749377-35749399 TAAAATAGTTCATCTTTTAAAGG - Intronic
1184428942 22:44429910-44429932 TAAATAGGTTCTGCTTGTGGAGG + Intergenic
1203325443 22_KI270738v1_random:10020-10042 AAAAATAATTCAACTTGTCGTGG + Intergenic
949289849 3:2451422-2451444 TAAAATAGTTTAGACTGGGGAGG + Intronic
951387689 3:22062568-22062590 TAAAATATTTAACATTGTGGTGG + Intronic
952375303 3:32762087-32762109 TATAAAAGTTTAGTTTGTGGTGG + Intronic
955305114 3:57822755-57822777 TAAGTCATTTCAGCTTGTGGGGG - Intronic
956913000 3:73840318-73840340 TAAAAAAGTTGAGCTTGGAGAGG + Intergenic
957963337 3:87289399-87289421 TAAAATAATTCATCTCATGGAGG + Intergenic
960351051 3:116593445-116593467 CAAAATATTTCAGAATGTGGAGG + Intronic
962207113 3:133443952-133443974 TAAAATAAATGAGCTGGTGGTGG - Intronic
962332912 3:134495777-134495799 TAAAAAAGTTCACCTCATGGAGG - Intronic
963818546 3:149861568-149861590 TAAAAAAGTTGATCTTATGGAGG + Intronic
964019972 3:151998226-151998248 TAAAATATTTCAACATATGGCGG + Intergenic
965024208 3:163277783-163277805 TATAATATTGCTGCTTGTGGTGG - Intergenic
965237565 3:166145272-166145294 GAAAATAGTTCAGATTTTGGAGG + Intergenic
966327659 3:178774949-178774971 CAAAAGAGTTCAACTTCTGGAGG + Intronic
966434600 3:179869250-179869272 AAAAATAATTCAGCTTCTGCTGG - Intronic
967039015 3:185672518-185672540 GTAAGTAGCTCAGCTTGTGGAGG - Intronic
971547050 4:27899175-27899197 TAAAATGGTACAGCTGCTGGGGG + Intergenic
971753498 4:30679689-30679711 TGAAACTGTTCTGCTTGTGGAGG - Intergenic
974518399 4:62946297-62946319 TAAAATAGTTAAACTTGCAGAGG - Intergenic
975487769 4:74953259-74953281 TTAAATAGTTCTGCTTATGCAGG + Intronic
975531181 4:75401180-75401202 TAAGATAGGTCAGCTGGGGGAGG + Intergenic
975539147 4:75486713-75486735 TAAAAAAATTCAGCTTCAGGAGG + Intronic
975621202 4:76298686-76298708 TAAAAAAGTTGACCTCGTGGAGG + Intronic
976674936 4:87693090-87693112 GAAAATAGTTGAGCCTCTGGGGG + Intergenic
976678704 4:87731527-87731549 TAAAATAGTTCAGGGTAGGGGGG - Intergenic
978595071 4:110368616-110368638 TAAAATGGTTCAGCTTAGCGAGG - Intronic
978605547 4:110475665-110475687 TAAATCAGTTCAGCTGGTGCTGG - Intronic
978814526 4:112888205-112888227 TAAAAAAAGTCAGTTTGTGGAGG + Intronic
978980957 4:114944920-114944942 TAAAAGAGGACAGCCTGTGGTGG + Intronic
979262393 4:118663526-118663548 TAAGATAGTTCAGCTGTTTGGGG - Intergenic
980193238 4:129552698-129552720 AAAAATATTTTAGTTTGTGGAGG + Intergenic
981391699 4:144198161-144198183 CATAATATTTCAGCTGGTGGAGG + Intergenic
982154672 4:152506676-152506698 TAAATTGTTTCAGGTTGTGGGGG - Intronic
982230075 4:153200618-153200640 TAAAATGGTTCAGCTGCTGTGGG - Intronic
984663192 4:182396550-182396572 TAAATTATTTCAGATTGAGGTGG + Intronic
984711760 4:182891173-182891195 TAAAATAGGGGAGCCTGTGGTGG - Exonic
987816133 5:22902329-22902351 TAAAATAGTACAACTTCTGATGG - Intergenic
990616778 5:57516712-57516734 AAAAAAAGTTCAGATAGTGGAGG + Intergenic
993315057 5:86393256-86393278 TAAAATAGTTTATCTCATGGAGG + Intergenic
994337381 5:98583658-98583680 TAAAATAGTTGAGCTTTTCAAGG + Intergenic
994455955 5:100008115-100008137 TTAAATAGTTCACCTTCTGGAGG - Intergenic
994619029 5:102140847-102140869 TAAATTAGTTCAGCTATTGAGGG - Intergenic
996368799 5:122731329-122731351 TAAAAAATTTGATCTTGTGGAGG - Intergenic
999002203 5:147936403-147936425 TAAAAAAGTTGATCTTATGGAGG - Intergenic
1000370643 5:160532691-160532713 TAAACTAGTTCAACTAGTTGTGG - Intergenic
1000469997 5:161629399-161629421 TCACATAGCTCAGCTTCTGGAGG + Intronic
1001687162 5:173602362-173602384 TTAAATAGATAAGCTTGTAGTGG - Intergenic
1001969473 5:175943036-175943058 TAAAAAAGTTAATCTCGTGGAGG + Intronic
1002247962 5:177900717-177900739 TAAAAAAGTTAATCTCGTGGAGG - Intergenic
1003667589 6:8126199-8126221 TAAATTAGTTCAGCCTTTGTGGG + Intergenic
1005659096 6:27976231-27976253 CATAATAGTTCAGCTCATGGTGG + Intergenic
1005770730 6:29068132-29068154 GAAAATAGTTCAGGTTTTGCAGG + Intronic
1006270530 6:32962904-32962926 TAAAAAAGTTGATCTTATGGAGG + Intronic
1009736079 6:67676915-67676937 TGAAATAGGACAGCTTGTTGGGG - Intergenic
1010656048 6:78512962-78512984 TAAAACAGTTCAGCTTTTGGAGG - Intergenic
1011640133 6:89411074-89411096 AGCAATCGTTCAGCTTGTGGGGG - Intronic
1013893476 6:115054803-115054825 GAAAATAGTTAAGATTGTGTTGG + Intergenic
1014146434 6:118003164-118003186 TAAAATAGTTCAGGATATGTGGG + Intronic
1014459829 6:121683082-121683104 TACAATAGTTCATCTTGAGGTGG - Intergenic
1014528180 6:122525716-122525738 TATAATATTTTTGCTTGTGGAGG + Intronic
1014623079 6:123693366-123693388 AAAAATAATTCAGATTGTGTGGG + Intergenic
1017111419 6:150936495-150936517 TTAAATAATTCAGCTGATGGTGG - Intronic
1017298225 6:152825013-152825035 TAAAAAATTTCAGCTTGTTAAGG - Intergenic
1017512534 6:155127035-155127057 TAAAATAATTTAGCTTGTAGAGG - Intronic
1021708833 7:23395255-23395277 TTAAATAGTTCAGGTTGTTTTGG - Intronic
1022262593 7:28720779-28720801 TAAAAGAAGACAGCTTGTGGTGG - Intronic
1028252017 7:88547853-88547875 TTTTATAGTTCAGCTTGAGGAGG + Intergenic
1030126607 7:106158603-106158625 AAAAAAATTTCATCTTGTGGAGG - Intergenic
1030933055 7:115548937-115548959 TAAAATAGTTTAAATTGTTGTGG - Intergenic
1031383864 7:121121753-121121775 TGAAATTGTTCAGGTTCTGGTGG + Intronic
1031490740 7:122384660-122384682 TAACATAGTTCAGAATGTGCAGG - Intronic
1031800303 7:126234735-126234757 TGAAATAGCTAAGCTTTTGGTGG + Intergenic
1032901341 7:136312341-136312363 TAAAAATGTTGATCTTGTGGAGG - Intergenic
1033031222 7:137829061-137829083 TAAAATAGTTCAGCTTGTGGTGG - Intronic
1033050106 7:137996428-137996450 TACATTTATTCAGCTTGTGGAGG + Intronic
1033955407 7:146841861-146841883 TAAAATTGTTCAGCTTGTCTTGG + Intronic
1036216804 8:6887253-6887275 TAAATTAGTAAACCTTGTGGAGG - Intergenic
1036703298 8:11028515-11028537 CAAAATAGTACAGCTATTGGTGG - Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1037941189 8:22952241-22952263 CAACCTAGTTCTGCTTGTGGTGG + Intronic
1039623996 8:39028823-39028845 TAAAATAGAGCAGAATGTGGAGG + Intronic
1040019855 8:42731266-42731288 TAAAATAGGGCAGGGTGTGGTGG + Intronic
1041523471 8:58779803-58779825 TAAAATAGTTGATCTCATGGAGG - Intergenic
1041984182 8:63900843-63900865 ACAAATAGGTCAGCTTGTGGCGG - Intergenic
1043233059 8:77826633-77826655 TAAAAAAGTTCATCTCTTGGTGG - Intergenic
1043624164 8:82233673-82233695 TAAAATACTTGATCTCGTGGAGG + Intergenic
1043725067 8:83601242-83601264 TAAAACAATTTAACTTGTGGAGG + Intergenic
1044047139 8:87450252-87450274 TAAAATAGTTGCGCTCATGGAGG + Intronic
1047016484 8:120728893-120728915 TAAATTAGTTCAGCTGCTGTGGG - Intronic
1047661296 8:127039804-127039826 TAAAATATTGCAGGTTCTGGGGG + Intergenic
1049712622 8:144072605-144072627 TAAAAAAGTTGATCTTGCGGAGG - Intergenic
1051252674 9:15177715-15177737 TAACATAGTTCAGCTTGCAAGGG + Exonic
1051412219 9:16801687-16801709 TAAAATATTTCAGCTTCTTTTGG - Intronic
1051984083 9:23062101-23062123 TAAAATACTTCAGATTTTAGTGG + Intergenic
1052599908 9:30613619-30613641 TAAAATAATTCATCTCATGGAGG + Intergenic
1053055051 9:34989098-34989120 TAAATGAGGTCAGCTTGAGGTGG + Intergenic
1055728985 9:79261414-79261436 TAACATAGTTCTGATTGTGAAGG - Intergenic
1055854128 9:80665599-80665621 TAAAACAGTTCATCTCATGGAGG - Intergenic
1056022949 9:82460352-82460374 TACAATGGTTCAGCTTCTGTGGG - Intergenic
1057201241 9:93141300-93141322 TAAAATAGGTCAGGGTGTGGTGG + Intergenic
1058435589 9:104959799-104959821 TAAAATATGATAGCTTGTGGAGG - Intergenic
1061679364 9:132235444-132235466 TACACTATTTCAGCCTGTGGAGG - Intronic
1061684288 9:132262203-132262225 TAATATTGTTCAGTGTGTGGCGG + Exonic
1188197889 X:27261206-27261228 TAAAATAGTTTAGCTGGTTTTGG + Intergenic
1191224688 X:58030993-58031015 TGGAATTGTTCAGCTGGTGGTGG + Intergenic
1191777557 X:64832845-64832867 TAAATTAGTTCAGCTATTGTGGG - Intergenic
1191930065 X:66362285-66362307 TAAAGAAGTTTATCTTGTGGAGG - Intergenic
1193909905 X:87291371-87291393 TAAATTAGAGCAGCTTGAGGGGG - Intergenic
1194806827 X:98339386-98339408 TAAAATTGTTCCTCTCGTGGAGG - Intergenic
1196009654 X:110873103-110873125 TAAGATAATTAAGGTTGTGGTGG + Intergenic
1196540028 X:116896872-116896894 AAAAATTGTTCATTTTGTGGAGG + Intergenic
1196752414 X:119129853-119129875 TTAATAAGATCAGCTTGTGGGGG - Intronic
1197964949 X:132050189-132050211 GAAAATGGGTCAACTTGTGGAGG - Intergenic
1200746599 Y:6909725-6909747 CAAAAAAGCTCAGGTTGTGGGGG - Intergenic
1202384463 Y:24312012-24312034 TAAGATAGTTCAGCTGTTTGGGG - Intergenic
1202486320 Y:25358110-25358132 TAAGATAGTTCAGCTGTTTGGGG + Intergenic