ID: 1033040085

View in Genome Browser
Species Human (GRCh38)
Location 7:137909653-137909675
Sequence CTCCATTGGAAGAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033040085_1033040089 -4 Left 1033040085 7:137909653-137909675 CCTTGTCCCTTCTTCCAATGGAG 0: 1
1: 0
2: 3
3: 29
4: 264
Right 1033040089 7:137909672-137909694 GGAGACCACCCAGCATACTATGG 0: 1
1: 0
2: 0
3: 4
4: 57
1033040085_1033040092 1 Left 1033040085 7:137909653-137909675 CCTTGTCCCTTCTTCCAATGGAG 0: 1
1: 0
2: 3
3: 29
4: 264
Right 1033040092 7:137909677-137909699 CCACCCAGCATACTATGGATGGG No data
1033040085_1033040095 5 Left 1033040085 7:137909653-137909675 CCTTGTCCCTTCTTCCAATGGAG 0: 1
1: 0
2: 3
3: 29
4: 264
Right 1033040095 7:137909681-137909703 CCAGCATACTATGGATGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 448
1033040085_1033040096 6 Left 1033040085 7:137909653-137909675 CCTTGTCCCTTCTTCCAATGGAG 0: 1
1: 0
2: 3
3: 29
4: 264
Right 1033040096 7:137909682-137909704 CAGCATACTATGGATGGGAAGGG No data
1033040085_1033040090 0 Left 1033040085 7:137909653-137909675 CCTTGTCCCTTCTTCCAATGGAG 0: 1
1: 0
2: 3
3: 29
4: 264
Right 1033040090 7:137909676-137909698 ACCACCCAGCATACTATGGATGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033040085 Original CRISPR CTCCATTGGAAGAAGGGACA AGG (reversed) Intronic
900765882 1:4505111-4505133 CTCCTTTAGAAGAAAGCACAGGG - Intergenic
901296182 1:8162430-8162452 CACCAGTGGAGGGAGGGACAGGG - Intergenic
902220417 1:14961006-14961028 TTCCACTCGAAGAAGGGACAGGG - Intronic
904130141 1:28269278-28269300 GTCCCTGGGAAGAAAGGACATGG + Intronic
904259381 1:29279713-29279735 TTCCATGGGCAGAAGGGAAATGG + Intronic
905274262 1:36806944-36806966 CTCCATTGGTTGAAGTGAAAGGG - Intronic
905312711 1:37061313-37061335 CACCATTGCAGGAAGTGACATGG - Intergenic
906212961 1:44022323-44022345 CTCCATGGTAGGAAGGGGCAGGG + Intronic
907591231 1:55673463-55673485 CTCCAATGGCTAAAGGGACAAGG - Intergenic
907671053 1:56475283-56475305 CTACATTGGCAGCAGGGAGACGG + Intergenic
908055670 1:60284080-60284102 CTCCATGGGACGGAGAGACAGGG - Intergenic
909481575 1:76132693-76132715 CTCCATCAGATGATGGGACATGG + Intronic
913212227 1:116591093-116591115 CTGCATTTGAAGAAGGGAGAAGG - Intronic
915841915 1:159220201-159220223 CTCATGTGGCAGAAGGGACAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
917695027 1:177513478-177513500 CACCATTGGCAAATGGGACAAGG + Intergenic
918222872 1:182451942-182451964 CCCCATTGCATGTAGGGACATGG + Intronic
919686224 1:200486342-200486364 CTCCTTTGTAAGAAGGGTTAAGG - Intergenic
921896878 1:220411072-220411094 CTCTATTGGAGGAAAGGGCAAGG - Intergenic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
922939928 1:229454180-229454202 CTCCATTGGATGAGGTAACAGGG + Intronic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
1063524295 10:6770196-6770218 CTCCAGTGGACAAGGGGACAAGG - Intergenic
1064152864 10:12879523-12879545 CCCCACTGGAACCAGGGACAGGG - Intergenic
1064795572 10:19007754-19007776 CTCCATAGGAAGCAAGGAAAAGG - Intergenic
1065538153 10:26734548-26734570 CCCCATTGAAAGGAGGGAAAAGG + Intronic
1065822351 10:29537527-29537549 CTACATTGTAAGAGGAGACAGGG - Intronic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1067018568 10:42775733-42775755 CCCCAATGGAATAAGAGACAAGG + Intergenic
1068770035 10:60810580-60810602 CTCCATTGGAGGAAGGAGCAGGG + Intergenic
1069878502 10:71577649-71577671 GTCCATTTGAATAAGGGATATGG + Intronic
1070458364 10:76640737-76640759 CTCCAAAGGAAGAATGGACTTGG - Intergenic
1071387429 10:85136112-85136134 CTCCTTTGGAGGAAGGGAGCAGG - Intergenic
1071980235 10:90998135-90998157 CTCCAGGGAAAGAAGGGAAAGGG - Intergenic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073265996 10:102228750-102228772 CTGCACTGGATGTAGGGACACGG - Intronic
1074354160 10:112767385-112767407 CTCCAGGTGAAGAAGGGACTTGG - Intronic
1074492974 10:113955502-113955524 CTCCAAAGGACGAAGAGACAAGG - Intergenic
1074929491 10:118109302-118109324 TCCCATGGGAAGAATGGACATGG - Intergenic
1075034319 10:119050606-119050628 ATCGATTGGAAGAACGGAAAAGG - Exonic
1075736665 10:124668643-124668665 CTCCCTAGGAAGATGAGACAAGG - Intronic
1076547526 10:131255184-131255206 CCCCACTGGCAGAGGGGACAAGG + Intronic
1077606750 11:3617460-3617482 CTCCGGTGGAAGAACAGACATGG - Intergenic
1079285284 11:19124630-19124652 TTCAATTGGAAGAAGGCAAAGGG - Intronic
1079390988 11:20022016-20022038 CTCCAGTGGAAGCAGGGAGCGGG - Intronic
1079417549 11:20253589-20253611 ATCCATTTGTAGAAGGTACAGGG + Intergenic
1079969163 11:27015459-27015481 CTCATGTGGCAGAAGGGACAGGG + Intergenic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080748324 11:35128974-35128996 CCCCATTAGAAGAAGAAACAGGG + Intergenic
1081962789 11:47150672-47150694 CATCATGGGTAGAAGGGACAGGG + Intronic
1083455250 11:62774446-62774468 GTCCATTGGATGTAGGGACCTGG + Intronic
1084589075 11:70079648-70079670 CTGCATGGGAAGAAGGTAGAAGG - Intronic
1085387943 11:76167874-76167896 CTCCATGCGAAGCAGAGACACGG + Intergenic
1085641890 11:78197918-78197940 CTCCTCTGGAACAGGGGACAGGG - Exonic
1086060264 11:82693093-82693115 CACCTTTGGAAGCAGAGACAAGG - Intergenic
1088024404 11:105160319-105160341 ATCCACTGGAAGGAGGAACAAGG + Intergenic
1088816159 11:113422473-113422495 CTCCTTTGGAAGAGGGAAGAAGG + Intronic
1088960494 11:114658912-114658934 CTACCATGGAAGAAGGGACAAGG + Intergenic
1089539992 11:119183999-119184021 CACAATTGGTAGAAGGCACACGG - Exonic
1090269855 11:125378470-125378492 CCCCATTGGAAGAAGCAGCAGGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1092140778 12:6182077-6182099 CTCCGCTGGAGGAAGGGACAGGG + Intergenic
1092525125 12:9305161-9305183 ACCCATGGGAAGAAGGGAGAAGG - Intergenic
1093469678 12:19487223-19487245 CTCCATTAGAAACAGGGAGAAGG - Intronic
1094643897 12:32302371-32302393 CTGAATTGGTGGAAGGGACACGG + Intronic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1096037404 12:48484458-48484480 CTTCATTGGCAGAAAGGCCAGGG - Intronic
1096466593 12:51850134-51850156 CTGCATTAGAAGAAGGGAGGGGG - Intergenic
1096619038 12:52850948-52850970 CTCAAGAGGAAGAAGAGACAGGG + Intergenic
1098182195 12:67859935-67859957 CTCCATAGGATGCAGCGACAAGG - Intergenic
1100010658 12:89948952-89948974 TTCCATTGAATGAAAGGACAGGG + Intergenic
1100209166 12:92383459-92383481 TTCCGTTTAAAGAAGGGACAGGG + Intergenic
1100602898 12:96127556-96127578 CTGCATTTTAAGAAGAGACATGG - Intergenic
1101463704 12:104925072-104925094 AGCAATTGGAAGAAGGCACAAGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102208158 12:111104898-111104920 CTTCTTTTGAAGAAAGGACAGGG + Intronic
1102573051 12:113839235-113839257 CTCCATGGGAAAAGGGCACAGGG + Intronic
1105215474 13:18281716-18281738 CTGCATTTGAAGAAGGGAGAAGG - Intergenic
1106871574 13:34027506-34027528 CTTGATTGGATGAAGGGAGATGG - Intergenic
1109120523 13:58450146-58450168 CTCACTTGGCACAAGGGACAAGG - Intergenic
1110305421 13:73981755-73981777 TTCTCTTGGCAGAAGGGACAAGG - Intronic
1110890973 13:80697744-80697766 CTCCATTAGAAAAAAAGACAGGG + Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1112283439 13:98082827-98082849 CTCATATGGTAGAAGGGACAAGG - Intergenic
1112453227 13:99531648-99531670 CTCTGTTGGAAGGAGGGAGATGG + Intronic
1113640142 13:111951523-111951545 CTCCATGGGGAGAGGGCACAGGG - Intergenic
1114182144 14:20376265-20376287 CTGCATTGGAAAAAGAGAGAGGG + Intronic
1118301880 14:64623705-64623727 TTGCTTTGGAAGAAAGGACAGGG - Intergenic
1118948616 14:70413250-70413272 CTCAACTGTAAGAAGGGACTTGG - Intronic
1119073168 14:71608054-71608076 CTCCATTAGAAGACTGGAAAAGG - Intronic
1121666772 14:95678178-95678200 CTCCTTGTGAAGAAGGGACCTGG + Intergenic
1121864841 14:97353202-97353224 CTCCGGTGGAAGGAGGGACTTGG - Intergenic
1122318442 14:100839359-100839381 CTCCTTTGGAAGAGGGGACAGGG - Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126999495 15:54485486-54485508 CTGCAGTAGAACAAGGGACAGGG - Intronic
1127008961 15:54601714-54601736 CTCCTTTGGAATGGGGGACAGGG - Intronic
1127542316 15:59952901-59952923 CTCAAATGGTAGAAGGGACCAGG + Intergenic
1127640781 15:60913915-60913937 TTCCATAGGAAGCAGTGACATGG - Intronic
1127817917 15:62628765-62628787 CTAGAGTGGAAGAAGGTACAGGG - Intronic
1128108259 15:65059825-65059847 CCCCAGTGGGAGAAGAGACAAGG + Intronic
1128185980 15:65643835-65643857 CTCCAGTGGAAAAGGGGAAATGG - Intronic
1128905399 15:71463564-71463586 CTCCAGAGGAAGAAAGGAAATGG + Intronic
1129862065 15:78870848-78870870 CTAAATTGTAAAAAGGGACAAGG - Intronic
1129970622 15:79774916-79774938 CTCCCTTGGAGGCAGGGGCAGGG - Intergenic
1131734618 15:95318920-95318942 CTACAGAGGAAGAAGGTACAAGG - Intergenic
1131883192 15:96880643-96880665 CTCCATTGGCAGAAAGAAGATGG + Intergenic
1132731479 16:1364623-1364645 CTCCAGGGGCAGACGGGACAGGG + Intronic
1133290625 16:4718453-4718475 CCCCACTGGCAGAAGGGAAATGG + Intronic
1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG + Intronic
1135734227 16:24918026-24918048 CTCCAGAGGAAGCAGGGACTTGG - Intergenic
1136586164 16:31186509-31186531 CTCCATCGGAAGAACGACCAAGG + Intronic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137341664 16:47613287-47613309 CTCCACTGGAAGAAGACACTTGG - Intronic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142257036 16:89018994-89019016 CGCCATGGCAGGAAGGGACACGG + Intergenic
1143453507 17:7051038-7051060 ATCAACTGGAAGAAGGGAGATGG + Intergenic
1144542555 17:16158805-16158827 CTCCACAGGAGGAGGGGACACGG + Exonic
1148440973 17:47711434-47711456 CTCCAGTGGAAGAAGGGTTGAGG - Exonic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1151169482 17:72234976-72234998 TGCCAGTGGAAGAAAGGACATGG + Intergenic
1152900199 17:82936812-82936834 CTTCAGTGGCAGCAGGGACAAGG - Intronic
1153878557 18:9399128-9399150 CTCCATCTGAAGAAGGCAAAGGG - Intronic
1156121314 18:33846105-33846127 TTTCTTTGGAAGATGGGACAAGG + Intergenic
1156540122 18:37901423-37901445 CTGCATTGGAAGAAGGAAGGTGG - Intergenic
1157924633 18:51749850-51749872 CTCCCATGGTAGAAGGGACAAGG + Intergenic
1158661239 18:59389989-59390011 CACCATTGGAATAAGGGAAAGGG - Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159942085 18:74416100-74416122 CTCCATTTGAAGTTGTGACATGG + Intergenic
1162971283 19:14182820-14182842 CTCCAAAGGTTGAAGGGACACGG - Intronic
925897582 2:8484931-8484953 CCCAAGTGGAAGAAGAGACAGGG + Intergenic
926364880 2:12123899-12123921 TTCCATTGGCAGAATTGACATGG + Intergenic
926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG + Intergenic
927417574 2:22894657-22894679 CTCGATTGGCAGAAGGGAGATGG + Intergenic
928427708 2:31192595-31192617 CCACAGTGGAGGAAGGGACAGGG + Intronic
928991436 2:37236376-37236398 CTCCACTGTAGGAAGGGAAATGG + Intronic
930266415 2:49204937-49204959 TGCCATTGGAAGAAGGCAGATGG - Intergenic
932128251 2:69164625-69164647 CTCCCTGGGAATTAGGGACATGG - Intronic
933619021 2:84515850-84515872 CTGCTTTGGTAGAAGGGGCACGG + Intergenic
934298856 2:91765011-91765033 CTGCATTTGAAGAAGGGAGAAGG + Intergenic
935326625 2:101943524-101943546 CTCCATTGGCAGAAGACACCTGG - Intergenic
937468866 2:122158230-122158252 CTGCATTGGAAGAATGGGAAAGG + Intergenic
938598485 2:132812878-132812900 CTCAAGTGGTAGAAAGGACAAGG + Intronic
939591614 2:144071213-144071235 CTCCATTGGAATAAATAACATGG + Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940764405 2:157774324-157774346 CTCCTCTGGAAGAAGGAAGAAGG + Intronic
942407858 2:175674948-175674970 CTCCACTGGAAATAGGGACCAGG - Intergenic
942563672 2:177246096-177246118 CTGCCTTGGGAGAAGGCACAGGG - Intronic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
946447913 2:219755353-219755375 CTCATATGGTAGAAGGGACAAGG - Intergenic
947034048 2:225830801-225830823 ATTCATTTTAAGAAGGGACAAGG + Intergenic
948196284 2:236099078-236099100 CTTCACTGCAAGGAGGGACAGGG + Intronic
948833529 2:240612772-240612794 CTCCAGAGGAAGAAGGGGAAGGG + Intronic
1170113533 20:12831434-12831456 CTCCAATGAAAGAAGGCTCATGG - Intergenic
1171494747 20:25548097-25548119 CCCCATGGCAAGGAGGGACAGGG - Intronic
1172837165 20:37880614-37880636 CTACCTTGGAAGAAGCTACAGGG - Intergenic
1172838611 20:37888576-37888598 CTCCACTGACAGTAGGGACAAGG - Intergenic
1172980115 20:38935115-38935137 CTCAATGGGGAGGAGGGACAAGG + Intronic
1173840625 20:46154450-46154472 CCCCTTTGGAAGAAGAGGCAGGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179436927 21:41368735-41368757 CTCCATGGGAAGAAAGAACAAGG - Intronic
1182467626 22:30527210-30527232 CTCCATAGCAGGAAAGGACAAGG + Intronic
1183285282 22:36958851-36958873 CTGTATGGGAAGAAGGGACAGGG - Intergenic
1184619359 22:45663288-45663310 CTCACTTGGAGGAAGGGAGATGG - Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949865850 3:8546582-8546604 CTACTATGGTAGAAGGGACATGG + Intronic
950137585 3:10592587-10592609 ATCCATTCTTAGAAGGGACAAGG - Intronic
950201541 3:11048098-11048120 GTCCAATGGGAGAAGGGACCTGG + Intergenic
950497494 3:13342745-13342767 CGCCATTGCAAAAAGAGACAAGG - Intronic
950912617 3:16610510-16610532 CTCCATTGCAACATGGGACAGGG + Intronic
951666585 3:25131715-25131737 GTCCAGTGGGAGAAGAGACAAGG + Intergenic
952576702 3:34782855-34782877 ATCCATGGAAAGAAAGGACAGGG - Intergenic
952995977 3:38882746-38882768 ATCCCTTGAAAGAAAGGACAAGG - Intronic
953487176 3:43311660-43311682 ATTCAGTGGAAGAAGAGACAAGG + Intronic
955400958 3:58591286-58591308 CTCAATGGGAAGATGAGACATGG + Intronic
955505952 3:59633338-59633360 TTCCATGGGAAGAAGGGACACGG - Intergenic
955572370 3:60321843-60321865 CTTCAGTGGTAGAAGGGGCAAGG + Intronic
958626631 3:96633278-96633300 CTCCTGTGGTAGAAGGGGCAAGG - Intergenic
958626930 3:96638275-96638297 CTCCATTGGAAAATGGGGAAAGG + Intergenic
959079096 3:101780808-101780830 CTGCTTTGGAAGAAGGGCAAGGG + Intronic
962308783 3:134311651-134311673 CTCCAGGGGAAGTAGGGGCAGGG - Intergenic
962991578 3:140582249-140582271 CTTCACTGAAAGAAGGAACAGGG + Intergenic
963905905 3:150773507-150773529 TTCCAATGGATGAAGGGAAAGGG - Intergenic
964745762 3:160011061-160011083 CTCCTCTGGGAGAAGGGAGATGG - Intergenic
966723786 3:183090284-183090306 CTCCACTGGATTTAGGGACATGG + Intronic
967329288 3:188274539-188274561 CCCCATTGGGAGGAGGGGCATGG + Intronic
967458956 3:189723031-189723053 ATCTCTTGGAGGAAGGGACAAGG + Intronic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
968050956 3:195654653-195654675 CTCTGATGGAAGAAGAGACAGGG + Intergenic
968104869 3:195993685-195993707 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968303164 3:197631269-197631291 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968467651 4:760571-760593 ATGCAGTGGAAGAATGGACAGGG - Intronic
969051583 4:4377066-4377088 CCCTATAAGAAGAAGGGACATGG - Intronic
971037869 4:22714782-22714804 CTCTATTGGAAGAGGGAGCAAGG + Intergenic
975587363 4:75963708-75963730 CATCATTGGCAGAAGGCACAAGG - Intronic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977799431 4:101208419-101208441 CTCCTGTGGAATAAAGGACATGG - Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978947211 4:114514740-114514762 CTCCAATGGTAAAAGGGGCAAGG - Intergenic
980521011 4:133934543-133934565 CCCCATTAGAAGAAGAAACAGGG + Intergenic
981567642 4:146117387-146117409 TTCCTTTTGAAGAAGTGACATGG - Intergenic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG + Intergenic
985670151 5:1202743-1202765 CTCCATGGTGAGAAGGAACAGGG - Intronic
985816457 5:2131637-2131659 CTCCTTGGGAACAAGGGCCAGGG - Intergenic
986018985 5:3783415-3783437 CCCCACTGGAATAAGGGCCAAGG - Intergenic
986086245 5:4453197-4453219 CTCCATTTGAAGTACGGAAAAGG - Intergenic
988836391 5:35036819-35036841 GTCCCTAGGAAGCAGGGACATGG - Intronic
990150855 5:52815589-52815611 CTCTGTTGGAAGAATGGAGAAGG + Intronic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
990806224 5:59665804-59665826 CTCACTTGGAAGAAGGGGCAAGG - Intronic
994100299 5:95884079-95884101 GTCCAGTGGGAGAAGGGACTGGG + Intergenic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994302930 5:98167554-98167576 GTCCATTGGAAGAAAATACAGGG - Intergenic
994631617 5:102295130-102295152 CTCCCTTGAAAGAAGGCACAGGG - Intronic
994881734 5:105506618-105506640 CTGCACTGGAGGAAGGGACTTGG - Intergenic
995366535 5:111367801-111367823 GTCCATAGGAAGAAGGAAGAAGG - Intronic
997224012 5:132195244-132195266 CTCCCTGTGAAGAAAGGACAGGG - Intronic
997333823 5:133089140-133089162 CTCCAGCTGAAGAAGGGTCAAGG + Exonic
997871068 5:137505500-137505522 CTCCAGGAGAAGAGGGGACAGGG - Intronic
1000140922 5:158402804-158402826 CTCTATTGGAAGATGGGGCAGGG - Intergenic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1004017068 6:11741824-11741846 CTCAATAGGAAGAAGGGATTTGG - Intronic
1004249862 6:14014974-14014996 GTCCAAAGGAAGAATGGACAGGG - Intergenic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1006288480 6:33116278-33116300 CTCCATTGAAAGAAGAAAGAAGG + Intergenic
1006611876 6:35298909-35298931 CTCCTTTGGAGGATGGGGCAGGG - Intronic
1007082301 6:39116424-39116446 CTGGATTGGAAGGAGGGAGAGGG + Intergenic
1007224793 6:40305406-40305428 CAGCATTGGAGGAAGGGCCAAGG + Intergenic
1008612632 6:53198066-53198088 CTGCATTGGAAGACGGGAGGAGG + Intergenic
1009259020 6:61459551-61459573 AGCCATTGGCAGAATGGACAAGG - Intergenic
1009259606 6:61467995-61468017 GTCCATTGGCAGAATGGACAAGG - Intergenic
1009859751 6:69312064-69312086 TTCCATTGGCAGAAGTGAAATGG - Intronic
1013675694 6:112459389-112459411 CTCATATGGTAGAAGGGACAAGG - Intergenic
1015379559 6:132551289-132551311 CTCCCAGGGAAGAAGGAACAAGG - Intergenic
1016657110 6:146531960-146531982 CTCCAGAGAAAGAAGCGACAGGG - Intergenic
1017721939 6:157249605-157249627 CTCCACTGGAACAAGGCTCATGG - Intergenic
1017904274 6:158746089-158746111 CTCCCATGGTAGAAGGGACAAGG + Intronic
1021483313 7:21142309-21142331 CTTCATTGGTAGGAAGGACACGG + Intergenic
1023658849 7:42453130-42453152 AGGCACTGGAAGAAGGGACAAGG - Intergenic
1025120627 7:56298530-56298552 CACCATTGTAATAAGGGAGAAGG - Intergenic
1027713590 7:81640777-81640799 CTCCCTGAGAAGAAAGGACATGG + Intergenic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1031500559 7:122509540-122509562 CTCTATTGGAAAAATGGCCAGGG - Intronic
1032651398 7:133882696-133882718 CACCATTGCAGGAAGGTACAAGG + Intronic
1033040085 7:137909653-137909675 CTCCATTGGAAGAAGGGACAAGG - Intronic
1034872090 7:154694124-154694146 CTCGCTTGGTGGAAGGGACAAGG + Intronic
1035396878 7:158540511-158540533 CTCCATGGGAGGAAAGCACATGG + Intronic
1036158103 8:6361170-6361192 CTGCAGTGGAAGAAGTGAAACGG + Intergenic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1037202308 8:16271314-16271336 TTTGATTGGAAGAAGGGCCAAGG + Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039080109 8:33725727-33725749 CTCCATAGGCAGAAGTGACAGGG - Intergenic
1040710587 8:50183957-50183979 CTTCATAGTAAGAAGGGATACGG - Intronic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1042012657 8:64265231-64265253 CTTCATTGGGATAAGGGAAATGG - Intergenic
1044122553 8:88415538-88415560 CTCCCTTGGAAAAGGGGACATGG + Intergenic
1044196275 8:89380118-89380140 TGCTATTGGAAGAAGGGAAAGGG - Intergenic
1045555212 8:103208838-103208860 TTGCATTGGGAGAAGGGAGAAGG + Intronic
1045881059 8:107041386-107041408 CTGCAATGGAAAAAGGGAAAGGG + Intergenic
1048080149 8:131117993-131118015 CTACATTGGAAAAAGTGAGATGG - Intergenic
1049865921 8:144935601-144935623 CCCAATTGGAAAAAAGGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1052736944 9:32352385-32352407 CTCCATGGGAAGCAGTGACAGGG + Intergenic
1052784646 9:32817263-32817285 CTCCCTGGGAAAAAGGGAAATGG - Intergenic
1053156987 9:35788180-35788202 TTTCTTTTGAAGAAGGGACAGGG + Intergenic
1053483465 9:38433730-38433752 CTCCCTGGGAAGAAGAAACAAGG + Intergenic
1054362430 9:64188443-64188465 AGCCATTGGCAGAATGGACAAGG - Intergenic
1054363016 9:64196888-64196910 GTCCATTGGCAGAATGGACAAGG - Intergenic
1055577651 9:77676368-77676390 CAGCAGTGCAAGAAGGGACAAGG - Intergenic
1055680843 9:78713619-78713641 TTCCATTACAAGAAGGGAAAGGG + Intergenic
1057204840 9:93164978-93165000 CTCCCTTGTAACAAGAGACATGG + Intergenic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1061290842 9:129649547-129649569 CTCCATGGGAAGAATCGCCATGG - Intergenic
1062058712 9:134483057-134483079 CTCCATAGGAGGAGGGGACGTGG + Intergenic
1187761704 X:22594326-22594348 GTCCATGTGAAGAAGGGAAAGGG - Intergenic
1187828573 X:23357598-23357620 CTCCATTGGTAGAAGAAAAATGG + Intronic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1189661355 X:43303223-43303245 CTTCATAGGAAGAAGGGTCTAGG + Intergenic
1193735862 X:85155408-85155430 CTCCTTTAGAAGTAGGGAGAAGG + Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1196343866 X:114629137-114629159 CTCCATTGGAAAAACAGAAACGG + Intronic
1196613049 X:117735650-117735672 CTACTTAAGAAGAAGGGACAGGG - Intergenic
1199628352 X:149760184-149760206 CTCCAGGGGATGAAGGGAAAGGG - Intergenic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200843239 Y:7805127-7805149 CCCCATTGGAAGGAGGGTCAGGG + Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic