ID: 1033041289

View in Genome Browser
Species Human (GRCh38)
Location 7:137920833-137920855
Sequence CATTCTGAACTACTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033041286_1033041289 10 Left 1033041286 7:137920800-137920822 CCAGTGGTAGCTGAAATGAAAGA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 1033041289 7:137920833-137920855 CATTCTGAACTACTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033041289 Original CRISPR CATTCTGAACTACTGGAGGT TGG Intronic
No off target data available for this crispr