ID: 1033042823

View in Genome Browser
Species Human (GRCh38)
Location 7:137933796-137933818
Sequence CAGCTGGGTGTCCTTGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033042817_1033042823 -7 Left 1033042817 7:137933780-137933802 CCCAGCAAATTAGCTCCAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG 0: 1
1: 0
2: 6
3: 25
4: 331
1033042814_1033042823 21 Left 1033042814 7:137933752-137933774 CCGGTTCCAACCAGATGCTATGA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG 0: 1
1: 0
2: 6
3: 25
4: 331
1033042816_1033042823 11 Left 1033042816 7:137933762-137933784 CCAGATGCTATGACTCAGCCCAG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG 0: 1
1: 0
2: 6
3: 25
4: 331
1033042815_1033042823 15 Left 1033042815 7:137933758-137933780 CCAACCAGATGCTATGACTCAGC 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG 0: 1
1: 0
2: 6
3: 25
4: 331
1033042819_1033042823 -8 Left 1033042819 7:137933781-137933803 CCAGCAAATTAGCTCCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 103
Right 1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG 0: 1
1: 0
2: 6
3: 25
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033042823 Original CRISPR CAGCTGGGTGTCCTTGGCAG TGG Intronic
900088671 1:909961-909983 CGGGTGGGGGTCCTGGGCAGGGG + Intergenic
901398338 1:8998685-8998707 CAGCAGGCTGTTTTTGGCAGGGG - Intergenic
901425167 1:9178048-9178070 AGGCTGGGTGTCCAGGGCAGGGG + Intergenic
901771235 1:11531363-11531385 CACCGGGGTGTCCCTGGGAGGGG + Intronic
902053456 1:13581990-13582012 CAGCTGGGGGTCCTGGGGTGGGG - Intergenic
902617522 1:17631980-17632002 CAGAGCTGTGTCCTTGGCAGTGG + Intronic
903222010 1:21874413-21874435 CAGCAGGGTCTCCGTAGCAGGGG + Exonic
903679755 1:25089078-25089100 GGGCAGGGTGTCCTAGGCAGCGG + Intergenic
904217321 1:28931890-28931912 TAGCTTGGTGGCCTTGGCAGGGG + Intronic
904534232 1:31188548-31188570 CAGATGGGGATCCTTGGAAGAGG - Intronic
905270053 1:36781816-36781838 CAGCTGGGTGACCTTGGGCCGGG + Intergenic
905340679 1:37275313-37275335 CAGCCGGGGGTCTTTGGCAGTGG - Intergenic
905972543 1:42153017-42153039 CAGCCAGGTGTCCTTGGCCCAGG - Intergenic
906402287 1:45513819-45513841 TACCTGGGTTTCCTAGGCAGAGG - Intronic
906928384 1:50143606-50143628 TAGCTGTGTGACCTTGGCAAGGG - Intronic
907574455 1:55513573-55513595 CAGCTGGGTGGCCATGGCTCAGG - Intergenic
912491663 1:110065900-110065922 CCGCTGGGGGTCCTTGCCAGAGG - Intronic
913524151 1:119675366-119675388 CAACTGGGTGTCCTTGGGAAGGG - Intronic
914097497 1:144556160-144556182 TACCTGGCTTTCCTTGGCAGAGG + Intergenic
914301497 1:146381458-146381480 TACCTGGCTTTCCTTGGCAGAGG - Intergenic
914444065 1:147734477-147734499 TACCTGGCTTTCCTTGGCAGAGG + Intergenic
915778969 1:158524151-158524173 CACCTGGGAGTCCTCAGCAGGGG + Intergenic
917964291 1:180168796-180168818 AACCTGTGTGCCCTTGGCAGAGG + Intronic
918755613 1:188337073-188337095 CAAATGTGTGTCCTCGGCAGAGG - Intergenic
919731260 1:200915014-200915036 CAGCTGGGTGGTCTTAGCACAGG - Intronic
919922053 1:202171819-202171841 CAGCTGGAAGGCCTTGCCAGGGG + Intergenic
920128584 1:203713226-203713248 CACCAGGGTGTGCTTGTCAGTGG - Exonic
922884927 1:229012162-229012184 AATCTGGGTGTCCAAGGCAGGGG - Intergenic
923460309 1:234204461-234204483 CAGCCCAGAGTCCTTGGCAGGGG - Intronic
923715990 1:236425200-236425222 CAGCTGGGTGCGCTCGCCAGGGG + Intronic
924257114 1:242193491-242193513 CAGCTGTGTGCCCTTGGCAAGGG - Intronic
1063374582 10:5546425-5546447 CAGGAGGGTGTCCTTGGCTCTGG - Intergenic
1067030737 10:42877683-42877705 CAGCTGAGTGCCCTAGACAGGGG - Intergenic
1067377117 10:45737824-45737846 CAGGTGGGTGTCCGTAACAGTGG - Intronic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1067884823 10:50078516-50078538 CAGGTGGGTGTCCGTAACAGTGG - Intronic
1069831822 10:71286496-71286518 CAGCTGGGTGGTCTTGGGAGGGG - Intronic
1072138314 10:92568084-92568106 CAGCAGGGTGTTCTCAGCAGAGG + Intronic
1072170820 10:92859927-92859949 CAACTGTGAGTCCTTAGCAGTGG + Intronic
1072317473 10:94216580-94216602 CAGCTAGGTATCCCAGGCAGAGG - Intronic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075476529 10:122739916-122739938 CACCTGCCTGTCCTGGGCAGTGG - Intergenic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1075784365 10:125038832-125038854 CTGCTGGGTGTCCTTGGCCGTGG - Intronic
1077133746 11:988171-988193 CAGCTCCGTGTCCGAGGCAGTGG + Intronic
1077138397 11:1012870-1012892 CAGCAGCCTGTCCTTGGGAGAGG - Exonic
1077541092 11:3146883-3146905 GAGCTGGGTGTGCTGGGAAGGGG - Intronic
1078489600 11:11756912-11756934 CAGATGGGTGTGCTTGGGGGAGG + Intergenic
1080599785 11:33810110-33810132 ATGCTGGGTGTTCTTGGAAGAGG + Intergenic
1081731372 11:45374014-45374036 CAACTGTGTGCCCTGGGCAGGGG + Intergenic
1083200409 11:61118086-61118108 CAACTGGGCGTCCTAGGGAGAGG + Intronic
1084006702 11:66326962-66326984 CAGCTGGGTGTCTTTAGCAGGGG - Intergenic
1084041590 11:66545999-66546021 CAGCTGGGTGTCCAGGCCATGGG - Exonic
1084308259 11:68300500-68300522 AAGCTTGGAGTCCTGGGCAGGGG - Intergenic
1084830793 11:71767581-71767603 CACCTGGCTTTCCTAGGCAGAGG + Intergenic
1084970279 11:72767786-72767808 CAGCTGTGTGGCCTTGGCTTGGG + Intronic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1085795283 11:79533622-79533644 TAGCTGTGTGACCTTGGGAGAGG + Intergenic
1086572026 11:88296063-88296085 CAGCTGGCTGTTGTTGGCAAAGG - Intronic
1089596861 11:119585962-119585984 CATCGGGCTGTCCTTGGCATGGG - Intergenic
1089652519 11:119923692-119923714 TTGCTGGGAGTCCTTGGGAGGGG - Intergenic
1090339984 11:126009321-126009343 CAACGGGGGGTCCTTGGCAGAGG - Intronic
1091290696 11:134437935-134437957 GGCCTGGGAGTCCTTGGCAGGGG + Intergenic
1091930665 12:4392718-4392740 GAGCTGGGTGTCTATGGGAGAGG + Intergenic
1092142270 12:6191937-6191959 CACCTGGCTTTCCTAGGCAGAGG + Intergenic
1092373088 12:7933376-7933398 AAGCTGGGTTCCCTTAGCAGAGG - Intronic
1094128174 12:27045547-27045569 CAGGTGTGTATCCTGGGCAGAGG + Intronic
1095854322 12:46843736-46843758 CACCTGGATGGGCTTGGCAGTGG + Intergenic
1096651525 12:53064206-53064228 CAGCTGGGTGGAACTGGCAGGGG - Exonic
1097188478 12:57208389-57208411 CAGCTGGGGGCCCTGGGCAGAGG - Intronic
1100616998 12:96238502-96238524 CAGCCGGGGGAGCTTGGCAGTGG + Intronic
1100650770 12:96586007-96586029 CTGCTGGGTGTCCTTCTCTGTGG + Intronic
1103941866 12:124505608-124505630 CAGCTGTGTGACCTTGGGTGAGG + Intronic
1104410903 12:128556866-128556888 TAGCTGGGTGTCTTTGGCTTGGG - Intronic
1105349018 13:19599834-19599856 CAGATGGATTTCCTTGGGAGAGG + Intergenic
1109897942 13:68719077-68719099 AAGCTGGGTGTTATTGTCAGAGG + Intergenic
1109959820 13:69615512-69615534 CACCTGGCTTTCCTAGGCAGAGG + Intergenic
1113653411 13:112053907-112053929 CACCTGGGTGACCTGGGCCGTGG + Intergenic
1113660624 13:112104589-112104611 GAGCTGGGTGTCCATGGCCTGGG - Intergenic
1113784805 13:112996863-112996885 CAGCTGAGGATCCTAGGCAGGGG - Intronic
1118438130 14:65789804-65789826 TGGCTGGGTGACCTTGGCCGAGG + Intergenic
1119026368 14:71155978-71156000 CATCTGCGTGGCCTTGGCTGGGG + Intergenic
1119662065 14:76459285-76459307 CGGCTGGGTGTCCCAGGCAGTGG + Intronic
1119904200 14:78286562-78286584 CAGCTGAGAGTCCAGGGCAGTGG + Intronic
1121421472 14:93818716-93818738 CATCTGGGTGTCACTGGCATAGG - Intergenic
1121493064 14:94373653-94373675 CTGCTGGGCTTCCTTGACAGAGG - Intergenic
1121517410 14:94561737-94561759 CAGCTGTGTGTCCCTGGGGGAGG - Intronic
1122246333 14:100405830-100405852 CAGGTGGGTTTCCTCGGGAGTGG - Intronic
1122922082 14:104884413-104884435 CAGCTGGGGGTCCGTGGGGGCGG - Exonic
1123650016 15:22470164-22470186 CAGCTGAGTCTCCTAGCCAGTGG + Intergenic
1124371370 15:29106536-29106558 CTCCTGTGGGTCCTTGGCAGAGG + Intronic
1127640237 15:60909270-60909292 CAGCTGGGAGTCTGTGGCTGAGG - Intronic
1127812867 15:62579721-62579743 CACCTGAGTTTCCTTGCCAGTGG - Intronic
1128559974 15:68658340-68658362 CAGCTGGGTGAGCCTGGCTGGGG + Intronic
1128771489 15:70285956-70285978 CAGCTGGGTGGCCTTGGCTGGGG + Intergenic
1129161200 15:73748874-73748896 CAGCTGGGTGCCATTGGCAGCGG + Intronic
1129227188 15:74176813-74176835 AAGCTGGCTGGCCTTTGCAGAGG - Exonic
1129848337 15:78778178-78778200 CAGCTGGCATTCCCTGGCAGCGG + Intronic
1130099110 15:80878701-80878723 CATCTCTCTGTCCTTGGCAGTGG + Exonic
1130105343 15:80924661-80924683 CGGCCGCTTGTCCTTGGCAGAGG - Exonic
1130253589 15:82315756-82315778 CAGCTGGCATTCCCTGGCAGCGG - Intergenic
1130679777 15:85986286-85986308 CATCTGGATTCCCTTGGCAGGGG + Intergenic
1131111252 15:89766584-89766606 CGGGTGGGTGTTCCTGGCAGAGG - Intronic
1131410769 15:92205905-92205927 TAACTTGGTGTCCTTGCCAGGGG + Intergenic
1131451379 15:92543115-92543137 CACATTGGTGTCCTGGGCAGAGG + Intergenic
1132348560 15:101123018-101123040 CAGCTTGGTGGCCTTGCCATGGG - Intergenic
1133002478 16:2858255-2858277 CGGCTGTGGGTCCTGGGCAGAGG + Intergenic
1133988256 16:10684780-10684802 CAGCAGGGTGAGCTTGGCATTGG - Intronic
1134259621 16:12640557-12640579 GAGCTGGCTGTCCTTTGAAGGGG - Intergenic
1134357100 16:13492446-13492468 CAAATGGGTGTTCTTGGCAAGGG + Intergenic
1134861552 16:17564927-17564949 CAGCTGGGTGTCCTTAGGCAAGG - Intergenic
1135855404 16:26005664-26005686 CATCATGGTGTCCCTGGCAGAGG + Intronic
1136143004 16:28299136-28299158 CAGCTGGGTGACCTTGGACAAGG + Intronic
1136664223 16:31794050-31794072 CACCTGGGTGGCCATGGCACAGG - Intronic
1137365943 16:47859513-47859535 CAGCTGGGTGTCCTGGCCCTGGG + Intergenic
1139435417 16:66934114-66934136 CAGCAGGGCGTTCCTGGCAGAGG - Intronic
1141045786 16:80715249-80715271 CAGTTCTGTGTCCTTGGCACTGG + Intronic
1142664625 17:1455749-1455771 GGGCTGGGTGACCGTGGCAGGGG - Intronic
1142675803 17:1512456-1512478 GAGCTGTGTGTCCTTTGGAGGGG - Intronic
1142985898 17:3695314-3695336 CAGCTGGGGGTCCTGCCCAGAGG - Intronic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1143782468 17:9236448-9236470 CAGCTGTATGTGCATGGCAGGGG + Intronic
1144320084 17:14107584-14107606 CAGCCAGGTGACCTTGGCTGTGG - Intronic
1145391716 17:22460481-22460503 CACCTGTGTGTCCTGAGCAGGGG + Intergenic
1146253754 17:31376098-31376120 CAGCTTGGCATCCTTGGCACTGG - Exonic
1146656052 17:34635937-34635959 TAGCTGGGGGTCTTGGGCAGGGG + Intronic
1146922818 17:36724742-36724764 CAGCTGTGTGACCTTGGGTGCGG + Intergenic
1147197000 17:38773722-38773744 CAGCAGGATCTCCTTGGAAGAGG + Intronic
1147950403 17:44104545-44104567 CGGCTGGGTGTCGATGCCAGAGG + Intronic
1148812649 17:50303758-50303780 CAGCAAGGTGACGTTGGCAGAGG + Intergenic
1148907987 17:50923318-50923340 CAGCAGGATGTCCATGGCTGAGG + Intergenic
1148912116 17:50948404-50948426 GAGCTGGCTGCCCTTGGCACTGG + Intergenic
1150136480 17:62698109-62698131 CACCTGGGTCTCCTGGGCTGTGG + Intergenic
1150452425 17:65279864-65279886 CACCTGTGTGTCCTTAACAGCGG + Intergenic
1150476276 17:65478308-65478330 GTCCTGGGTGTCCCTGGCAGTGG - Intergenic
1151368500 17:73632055-73632077 CAGCAGGGTCCCCTTGGGAGGGG + Intronic
1151671059 17:75571892-75571914 CAGCTGGATCTCCTTGGCTAGGG - Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152379743 17:79936249-79936271 CAGCTGTGTGTCCTCCGCCGAGG - Exonic
1152469128 17:80481305-80481327 CCGCAGGGTGTCCTGGGCAGAGG + Intergenic
1152621578 17:81367479-81367501 CAGCTGGGGGGCCTTGGACGAGG + Intergenic
1152631836 17:81413986-81414008 CACCTGGGTGCCCTTGGGATGGG + Intronic
1152910501 17:83002723-83002745 CAACAGGGTGTCCTCGGCAGTGG - Intronic
1152992401 18:375329-375351 CAGGAGAGTGTCCTAGGCAGAGG - Intronic
1153789505 18:8564941-8564963 CAGCTGGCCCTCCTAGGCAGAGG - Intergenic
1156457075 18:37300845-37300867 CATCTGGGGGTGCCTGGCAGAGG + Intronic
1157423732 18:47567601-47567623 CAGCAGGGAGTCCTAGGCTGTGG + Intergenic
1157799610 18:50608838-50608860 TATCTGGGTTTCCTGGGCAGGGG + Intronic
1160507532 18:79435639-79435661 CATCTGGGTGTCTTGGGCTGAGG + Intronic
1160859788 19:1232950-1232972 CTGCTGTGTGACCTTGGCCGAGG - Intronic
1160989044 19:1853131-1853153 CACCTTTGTGTCCTTGTCAGCGG - Exonic
1161209186 19:3057415-3057437 CCCCCGGCTGTCCTTGGCAGCGG - Intronic
1162376504 19:10308451-10308473 GACCGGGGTGTCCTGGGCAGGGG + Exonic
1162447534 19:10732647-10732669 AGGCTGGGTGTCCTTTGCATGGG + Intronic
1163119826 19:15210701-15210723 CAGCTGGGTGTCTCAGGCAGAGG - Intergenic
1166052470 19:40268454-40268476 CAGCTGGGTGGCCTTGGGCAGGG + Intronic
1166919902 19:46222089-46222111 CAGCTGGCCGTCCTTGGCCTTGG - Intergenic
1166939337 19:46353378-46353400 CAGCTGGGTGGAGTGGGCAGGGG - Intronic
1166939979 19:46356593-46356615 CTGCTGGGTGACCTTGGAGGAGG - Intronic
1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG + Exonic
1167342298 19:48922945-48922967 CAGCTGGGTGCCAGGGGCAGGGG + Exonic
1167449159 19:49556884-49556906 CAGCTTGGTGGCCTTGGCTTCGG + Exonic
1167637066 19:50661483-50661505 CAGCTGTGTGTGCTGGGGAGAGG + Intronic
1168405493 19:56108284-56108306 GAGCTGGGAGTTCTGGGCAGGGG - Intronic
1168411388 19:56142319-56142341 CAGCTCTGTGTCCTTGGACGAGG - Intronic
925045286 2:768629-768651 CATCTGGGAGTCCTTGGGTGTGG - Intergenic
925058267 2:871903-871925 CAGCCTGGGGTCCTGGGCAGAGG + Intergenic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928540033 2:32276218-32276240 CACCTGGCTTTCCTAGGCAGAGG + Intergenic
930018647 2:46987419-46987441 AAGCTGGTTGTCCCTGTCAGTGG + Intronic
930946112 2:57078053-57078075 CAGTTGGGGGTCCAAGGCAGAGG - Intergenic
931388311 2:61816895-61816917 CAGCTGGGAGTCAGTTGCAGGGG + Intergenic
931782361 2:65589760-65589782 CAGCAGAGGGTTCTTGGCAGAGG + Intergenic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
935503908 2:103875062-103875084 CAGAGTGGTGTCCTTGGGAGAGG + Intergenic
936468348 2:112775114-112775136 CTACTGGGTGTGCTTGGCAGGGG - Exonic
936714367 2:115168055-115168077 CAGGAGAGTGTGCTTGGCAGTGG + Intronic
937023702 2:118680546-118680568 CAGCTGAGAGTCATGGGCAGGGG - Intergenic
937158136 2:119735814-119735836 CCGCTGGGAGGCCTTGGCGGGGG - Intergenic
937252982 2:120535631-120535653 CAACTGAGTGTCTGTGGCAGGGG + Intergenic
937353796 2:121185586-121185608 AAGCTGGGTGACCTTGGCCTTGG - Intergenic
937876897 2:126832757-126832779 CAGCGGGGTGTGCCTGGTAGGGG + Intergenic
938169244 2:129060028-129060050 CTTCTGGGTGCCATTGGCAGAGG + Intergenic
938407898 2:131042764-131042786 CAGCTGGGAGTGGTTGGCGGTGG - Intronic
940335694 2:152525080-152525102 TATCTGGGTGACCTTGGCATTGG - Intronic
941911636 2:170770572-170770594 GAGATGGGTGTCCCTGGTAGTGG - Intergenic
942420518 2:175802279-175802301 CATATGGGTGTCTGTGGCAGGGG - Intergenic
946335082 2:219030818-219030840 CAGCTGGGCGCACTTGGCTGGGG + Exonic
946487722 2:220117087-220117109 CCCCTGGGTGTCTTTGGCATAGG - Intergenic
947690653 2:232133010-232133032 CAGCTGGGTGGCATTAGCAAGGG + Intronic
947808764 2:232986696-232986718 GGGCTGGGGGTCCTTGGCAAAGG + Intronic
947880163 2:233501844-233501866 CAGCTGGATGTTCTGGGCCGAGG + Intronic
948126321 2:235567168-235567190 CAGCGGGCAGCCCTTGGCAGAGG + Intronic
948619238 2:239223620-239223642 CAGATGGGTGGCCTTGGTAAGGG + Intronic
949051435 2:241899618-241899640 GACCTGGCTGTTCTTGGCAGGGG + Intronic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1171325717 20:24290644-24290666 CAACTGGGTGCACTTGACAGAGG - Intergenic
1172106292 20:32519076-32519098 CTGCTGTGTGTCCTGGGCAAGGG - Intronic
1172749923 20:37243689-37243711 CTGCTGGGTGTCCTGGTCACTGG + Intergenic
1172807523 20:37623048-37623070 CAGCTGGGTTGGCTTGGCTGGGG - Intergenic
1173859173 20:46270825-46270847 GAGCTGGGTTGACTTGGCAGTGG + Intronic
1175191515 20:57215111-57215133 CAGCTGGGTGCCCATGGCCTGGG - Intronic
1175444043 20:59008051-59008073 CTGCTGGGGGCCCTTGGCACAGG + Intergenic
1175722480 20:61295674-61295696 CAGCAGAGTGGCCTGGGCAGAGG + Intronic
1175771692 20:61628193-61628215 CAGCCGGGGGTCCTGGGAAGGGG - Intronic
1179252017 21:39678532-39678554 CAGCTGGGTGTCCTTGGGAAGGG + Intergenic
1179252032 21:39678679-39678701 TAGCTGGGTGTCTCTGGCACGGG + Intergenic
1179585264 21:42370461-42370483 CAGCTGGGTGTCCTTGTAAAGGG - Intergenic
1180053447 21:45344536-45344558 CAGCTGTGTGTCCAGGGCCGAGG - Intergenic
1181306809 22:21921660-21921682 CTGCTGGGAGTCCATGGCACAGG - Exonic
1181534868 22:23536371-23536393 CACCTGGCTTTCCTAGGCAGAGG - Intergenic
1181750291 22:24984432-24984454 TAGCTGGGTGTCCAGGGCACGGG + Intronic
1181803875 22:25363632-25363654 CAGCTGTGTGTCCTTGGGCCGGG - Intronic
1182006611 22:26965423-26965445 AAGGTGGGAGTCCTTGTCAGGGG + Intergenic
1182429956 22:30293586-30293608 CAGGTGGGGGTCCTTTGAAGGGG - Intronic
1183282950 22:36942448-36942470 ATGCTGGGTGTCCTGAGCAGGGG + Intergenic
1183347059 22:37313718-37313740 CAGCTGGGTGCCCAGGCCAGGGG - Exonic
1184550529 22:45202156-45202178 CAGGGGGGTGCCCTTGGCACAGG - Intronic
1184552203 22:45210435-45210457 CATATGAGTGCCCTTGGCAGGGG - Intronic
1184839289 22:47043200-47043222 AGGCAGGGTGTCCATGGCAGGGG + Intronic
1185167793 22:49272098-49272120 CAGCTGGGTGTCCTTGGAACTGG + Intergenic
1185187788 22:49413274-49413296 CAGCAGGGGGTGCTTGGAAGAGG - Intergenic
1185341588 22:50293539-50293561 CAGCTCGGTGGCAGTGGCAGAGG + Intronic
949200860 3:1377971-1377993 CAGTTGGGAGTCCTTGGTGGGGG - Intronic
949932755 3:9092024-9092046 CACCTGGACGTTCTTGGCAGTGG + Intronic
950021881 3:9793140-9793162 CAGCCGGGGGTCCCTGGCCGGGG - Exonic
950205084 3:11073890-11073912 AGGATGGGTGTCCTAGGCAGTGG - Intergenic
951382779 3:22004955-22004977 CAGATGGGTGTCCTTAGCTTTGG + Intronic
953126813 3:40098415-40098437 CAGCTGTGGGTAGTTGGCAGTGG + Intronic
956775939 3:72565631-72565653 CGGCAGGGTGTCCTGGGCAGGGG + Intergenic
959951353 3:112184070-112184092 CAGCTGGGTGGTCTTAGCACAGG + Intronic
960403028 3:117227135-117227157 CAGATGGGTGCCCTGGGCATTGG + Intergenic
961408907 3:126704339-126704361 CCGCAGGGTGTCCTTCGGAGTGG + Exonic
961410715 3:126718465-126718487 CAGCTGTGTGACCTTGGCCAGGG - Intronic
961826682 3:129602918-129602940 CAGCTGTGTGACCTTGGCCAAGG - Intronic
962372768 3:134834485-134834507 CAGCTGGGTGTCATCCCCAGGGG + Intronic
962731790 3:138290225-138290247 AAGCTGGGAGTCAGTGGCAGAGG + Intronic
962972888 3:140421212-140421234 CACCAGGGTGTCCTGAGCAGCGG - Exonic
966450702 3:180057785-180057807 CAGCTGTGTGTGCTTGGATGTGG - Intergenic
967227435 3:187305491-187305513 CAGCTGGGAGGCTGTGGCAGTGG + Intergenic
967768317 3:193306961-193306983 CAGTTGTGTGACCTTGGGAGGGG + Intronic
967840230 3:193999130-193999152 CAGCTGGGAGTCCTTTGCTGCGG + Intergenic
968235254 3:197027478-197027500 CATCTGGGCCCCCTTGGCAGGGG + Intronic
968646196 4:1741772-1741794 CAGGTGGGTGTCAGTGGCTGGGG + Intronic
968917965 4:3505482-3505504 CAGCTGCCTGTGCCTGGCAGGGG + Intergenic
969347898 4:6580683-6580705 CAGATGGGGGTCCCTGCCAGGGG - Intronic
969525731 4:7703163-7703185 CAGCCGGGGGTTGTTGGCAGAGG - Intronic
969534530 4:7747715-7747737 CAGCTGGGAGTCTGTGGCTGTGG + Intergenic
969714834 4:8863433-8863455 CAGCTGGGTTGCCTTCGGAGTGG + Intronic
969718096 4:8877989-8878011 CAGCTCGGTGGCCCTGGCACAGG - Intergenic
970518340 4:16857647-16857669 CTGCTGCATGGCCTTGGCAGTGG + Intronic
971105893 4:23524194-23524216 CAGCTGGGGGACATGGGCAGGGG - Intergenic
971364949 4:25970281-25970303 CAGCTGAGTGTCCTGGGGAGGGG - Intergenic
973698192 4:53511807-53511829 CTGTTGGGTGACCTTTGCAGAGG - Intronic
973980421 4:56304110-56304132 CAGCTGGGGGATGTTGGCAGGGG - Intronic
974216512 4:58854097-58854119 CCACTGGGTGTCCATAGCAGAGG - Intergenic
978789252 4:112643700-112643722 TAGCCGGGTGTGATTGGCAGTGG + Intronic
981667520 4:147246367-147246389 CAGCTGTGTGACCTTGGAAATGG + Intergenic
983205472 4:164906150-164906172 CACCTGGCTTTCCTAGGCAGAGG + Intergenic
984013598 4:174401070-174401092 TACCTGGCTTTCCTTGGCAGAGG - Intergenic
985492611 5:188229-188251 CACGTGGGTGACCTTGGGAGAGG - Exonic
985636522 5:1038376-1038398 GAGCGAGGTGTGCTTGGCAGTGG - Exonic
986280940 5:6321866-6321888 AAGCAGGGAGTCCCTGGCAGGGG - Intergenic
986734701 5:10660352-10660374 CAGCAGTGTGGCCTGGGCAGGGG + Intergenic
988790536 5:34603572-34603594 GAGCTGAGTGTCCTAGGCATGGG - Intergenic
988791899 5:34616131-34616153 CTGCTGGGTGACCAGGGCAGAGG + Intergenic
989170959 5:38469935-38469957 AAGCTGGGAGCCCTTGGGAGTGG + Intergenic
992471912 5:77066010-77066032 CAGAGGGATGTCCTTGGCAGGGG + Intergenic
995214084 5:109574708-109574730 CAGAAAGGTGTCCTTGGCAGTGG - Intergenic
997210460 5:132074002-132074024 CAGCTGGGTGGCCTAGGCACAGG - Intronic
997640396 5:135445112-135445134 CTCCAGGGTCTCCTTGGCAGGGG + Exonic
998392073 5:141793597-141793619 CATCTGGGAGTCCTTAGGAGGGG - Intergenic
998655497 5:144173995-144174017 CAGCTGGGTGACTTTAACAGAGG - Intronic
999332906 5:150689395-150689417 CAGCTGTGTGCCCTAGGCAATGG + Intergenic
999523713 5:152380102-152380124 TAGCTGGGTGTCCCTGGCTCTGG + Intergenic
1000221662 5:159220217-159220239 CAGCTGTGTGACCTTGGCCGAGG + Intergenic
1001300861 5:170532742-170532764 CAGCTGAGTGTCCAGGGCAGGGG - Intronic
1001493555 5:172172487-172172509 TGGCTGTGTGTCCTTGGCACTGG + Intronic
1001759800 5:174197924-174197946 CTGCTGCGTGGCCTTGGCTGTGG - Intronic
1002186555 5:177457388-177457410 CAGGTGGGCGGCCTTGGCAAGGG + Exonic
1002471190 5:179437276-179437298 CAGCAGGGTGACTTTGGCAAAGG + Intergenic
1003306937 6:4937599-4937621 CAGCTTGCTGTCATCGGCAGCGG - Exonic
1005029141 6:21493161-21493183 GAGCTGGGTGCCCTTGGCTGAGG - Intergenic
1005139961 6:22619417-22619439 CAGCTGGGGGCAGTTGGCAGGGG - Intergenic
1005738408 6:28769910-28769932 CTCCTGGATGTCCTTTGCAGTGG + Intergenic
1005813475 6:29532793-29532815 CTGCTGGGTGGCCTGGGCTGTGG - Intergenic
1006122617 6:31816418-31816440 CAGGTGGGTGTCCCCGGCCGTGG - Exonic
1006124480 6:31828612-31828634 CAGGTGGGTGTCCCCGGCCGTGG - Exonic
1006517846 6:34554662-34554684 AAGCTGGGGGTCCTTGGCTCTGG + Intronic
1007219905 6:40270217-40270239 GAGCTCTGTGTCCTGGGCAGAGG + Intergenic
1007273369 6:40655610-40655632 CAGCTGAGCATCTTTGGCAGTGG - Intergenic
1007622433 6:43223255-43223277 CAGCAGGGTTTCCTCTGCAGAGG - Exonic
1007712534 6:43833821-43833843 CAGCTGGGCATCCTTGGTTGGGG - Intergenic
1011525840 6:88263918-88263940 CACCTGGGTCTCCTTCCCAGTGG - Intergenic
1014513515 6:122354323-122354345 CAGATAAGTGTCCTTGTCAGTGG + Intergenic
1015285207 6:131478967-131478989 CACCTGGCTTTCCTAGGCAGAGG - Intergenic
1016305092 6:142675730-142675752 CTGCTGGGTGGCCCTGGGAGAGG - Intergenic
1019007794 6:168817008-168817030 CACCTGGGTTTCCCTTGCAGGGG - Intergenic
1019303473 7:321465-321487 CAGGTGAGTGTCCTGGGCAAAGG - Intergenic
1019620652 7:1990308-1990330 CAGCTGGGCATCCTGGCCAGAGG + Intronic
1020264826 7:6553401-6553423 CAGCTGGGTGACCTTGGGTTAGG - Intergenic
1021352021 7:19605625-19605647 CAGCTGGCTGCCCCTGGCTGGGG - Intergenic
1022413898 7:30161573-30161595 AACTTGGGTGTCCTTGGCAGCGG + Exonic
1022637643 7:32152253-32152275 CAGTTGTGTGTCCTTGGGCGTGG + Intronic
1024512271 7:50213318-50213340 GAGCAGGGTGTACATGGCAGGGG + Intergenic
1025750731 7:64291793-64291815 CAGCTGGGTGTGCATAGGAGAGG + Intergenic
1025818989 7:64945955-64945977 CAGGTGGCTGTGCTTGGCATGGG - Intergenic
1029379300 7:100202319-100202341 CAGCCGGGAGACCTGGGCAGTGG + Exonic
1029598587 7:101550694-101550716 CAGCTGGGTGGCGATGTCAGGGG + Intronic
1032362954 7:131273102-131273124 TAGCTGGGTGATCTTGGCAAAGG - Intronic
1032958094 7:136997051-136997073 CAGCTGGTAGTCCTTGGAGGGGG - Intronic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1034265132 7:149777051-149777073 CTTCTGGGAGTCCTGGGCAGGGG + Intergenic
1034827045 7:154275164-154275186 CATCTGGCAGTCCTTGGCTGAGG - Intronic
1034926076 7:155123097-155123119 CAGCAGGGAGTCCTTGGCCATGG - Intergenic
1034993190 7:155560880-155560902 GAGCAGGGTGACCATGGCAGCGG + Intergenic
1035265635 7:157689124-157689146 CAGAGGGGTGTGCTTGGGAGGGG + Intronic
1035457798 7:159020546-159020568 CAGCTGGGAGTCCTATGCAAGGG + Intergenic
1035457813 7:159020628-159020650 CAGCTGGGAGTCCTATGCAAGGG + Intergenic
1036127690 8:6078377-6078399 CAGCTGGGTGTCTCTCACAGAGG - Intergenic
1037646282 8:20795594-20795616 TCGCTGGGTGGCCGTGGCAGTGG + Intergenic
1039870773 8:41543361-41543383 CATCTGGCTGTCCTTGGCCAAGG + Exonic
1040603130 8:48903934-48903956 CACCAGGCTGTCCTGGGCAGAGG + Intergenic
1040892076 8:52327681-52327703 CAACTGGGTGGCACTGGCAGAGG - Intronic
1041046597 8:53893170-53893192 TAGCTGGTTGACCTTTGCAGAGG + Intronic
1041732045 8:61072195-61072217 CAGCTGGGTGTTGAAGGCAGCGG - Intronic
1048009267 8:130443302-130443324 CAGCGGGGTGTCCTTCTCCGCGG - Intronic
1049015069 8:139914307-139914329 CACCTGGGTGTCCCTGCCTGCGG - Intronic
1049206205 8:141364793-141364815 TAGCTGGGTGTCTCTGGGAGGGG + Intronic
1049593636 8:143473656-143473678 CCCCTGGGCCTCCTTGGCAGAGG - Intronic
1051671569 9:19515879-19515901 CAGCGAGGTGTACTTGTCAGTGG + Exonic
1056567334 9:87785599-87785621 CACCTGGCTTTCCTGGGCAGAGG + Intergenic
1056625491 9:88249688-88249710 CAGCTTGGTGTCCTTGGGTCAGG - Intergenic
1057080860 9:92173406-92173428 CAGCGGGAGGTTCTTGGCAGTGG - Intergenic
1057139562 9:92718364-92718386 CAGCTGGGGGCCCTGAGCAGGGG + Intronic
1057503375 9:95613372-95613394 TAGTTGGGTGTCTTTGGGAGTGG + Intergenic
1057675120 9:97131815-97131837 CAGCAGGATGTGCTGGGCAGTGG - Intergenic
1058577436 9:106419057-106419079 CAGTGGTGTGTTCTTGGCAGGGG - Intergenic
1060269622 9:122131486-122131508 GAGAAGGGTGTTCTTGGCAGAGG - Intergenic
1061119174 9:128632748-128632770 CAGGTGGGTGCCCCGGGCAGAGG - Intronic
1061296433 9:129679328-129679350 GAGCTGGGTGACGGTGGCAGGGG + Intronic
1061435180 9:130556711-130556733 TAGCTGGGTGTTTCTGGCAGGGG - Intergenic
1061801432 9:133115286-133115308 CAGCCAGGTCTCCTTGGGAGGGG - Intronic
1061806109 9:133138502-133138524 CAGCTGGGTGTGCCAGGCAGTGG + Intronic
1061873046 9:133530820-133530842 CAGCTGGGTGACTTTGGGCGAGG - Intergenic
1062549607 9:137079911-137079933 CAGCTGGGTGTGCTCAGAAGTGG + Intronic
1188213287 X:27448151-27448173 CTGCTGGCAGTCCTTGGCTGTGG + Intergenic
1188277469 X:28217969-28217991 CTGGTGGGTGTCCTTGTAAGAGG - Intergenic
1188474205 X:30573159-30573181 TAGCTGTGTGGCCTTGGAAGGGG - Intronic
1189025030 X:37385644-37385666 CAGCTGGGTGGTTTTGGCATAGG + Intronic
1192152630 X:68721644-68721666 CATCTGGTTTTCCTCGGCAGAGG - Exonic
1193089791 X:77482010-77482032 CACCTGGCTGTCAGTGGCAGGGG - Intergenic
1193136777 X:77980599-77980621 CAACTGGTTTTCCTTGGGAGAGG - Intronic
1193978129 X:88149003-88149025 CAACTGGGTGTCCTAGGGACAGG - Intergenic
1197771072 X:130089757-130089779 CTGCTGTGTGTTCTTGCCAGAGG - Intronic
1199600299 X:149537740-149537762 CTCCTGGGTGTGCTGGGCAGTGG - Intergenic
1199650285 X:149942200-149942222 CTCCTGGGTGTGCTGGGCAGTGG + Intergenic
1200756268 Y:6992722-6992744 CAGATGGATTTCCTTGGTAGTGG + Intronic
1202237492 Y:22728776-22728798 CATCTGGGTTGCCTTGGCAATGG + Intergenic
1202342309 Y:23882502-23882524 CAGATGGCTTTCCTTGGCTGTGG + Intergenic
1202528460 Y:25787583-25787605 CAGATGGCTTTCCTTGGCTGTGG - Intergenic