ID: 1033044136

View in Genome Browser
Species Human (GRCh38)
Location 7:137945793-137945815
Sequence CACCCGCCTCCTCATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033044132_1033044136 9 Left 1033044132 7:137945761-137945783 CCTCAAATGCTGGAAAGGAGCTC 0: 1
1: 0
2: 2
3: 8
4: 188
Right 1033044136 7:137945793-137945815 CACCCGCCTCCTCATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033044136 Original CRISPR CACCCGCCTCCTCATGAGGG TGG Intronic
No off target data available for this crispr