ID: 1033045872

View in Genome Browser
Species Human (GRCh38)
Location 7:137961827-137961849
Sequence ATGGAGGAAAGGCCTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033045872_1033045884 27 Left 1033045872 7:137961827-137961849 CCTACCCCAGGCCTTTCCTCCAT 0: 1
1: 0
2: 4
3: 59
4: 521
Right 1033045884 7:137961877-137961899 CCCAATGCTCAGTCTCTCCGTGG 0: 1
1: 0
2: 2
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033045872 Original CRISPR ATGGAGGAAAGGCCTGGGGT AGG (reversed) Intronic
900298312 1:1964039-1964061 ATGAAGGACAGGTCTGGGGGTGG + Intronic
900394500 1:2447615-2447637 AGGCAGGAAAGGCTTGGGGGTGG + Intronic
900974906 1:6010927-6010949 AAGGAGGAAAGAGCTGGGGCAGG - Intronic
901139014 1:7016011-7016033 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901165252 1:7216260-7216282 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901897859 1:12330001-12330023 ATGAAGGAAAGGGCAGGGGTGGG + Intronic
902231059 1:15027913-15027935 AAGGAAGAAAGGTCTGTGGTGGG + Intronic
902466569 1:16622129-16622151 ATGGGGGAAAGGGCAGGGTTGGG + Intergenic
902508090 1:16950917-16950939 ATGGGGGAAAGGGCAGGGTTGGG - Intronic
902624116 1:17666867-17666889 TTGGAGGAAAGAGATGGGGTGGG - Intronic
903305242 1:22408554-22408576 TTTGAGGTTAGGCCTGGGGTTGG + Intergenic
903502432 1:23808561-23808583 AGGGAGGAAAGCACGGGGGTTGG - Intronic
904354680 1:29931182-29931204 AGGCAGGTAAGGACTGGGGTGGG - Intergenic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
904593012 1:31625676-31625698 AGAGAGGAGAGGCCTGGAGTGGG - Intronic
904681839 1:32234669-32234691 ATGGAGGGTAAGGCTGGGGTTGG + Intergenic
905241238 1:36582965-36582987 CTGGAGGATGGGCCTGGGGGAGG - Intergenic
905538831 1:38744372-38744394 AGAGAGGAAAGACCTGGGTTCGG - Intergenic
905883367 1:41478674-41478696 AAGAAGGAAAGGGCTGGGGCAGG - Intergenic
906248450 1:44293397-44293419 AAGAAGGAAAGGCCTGAGGCAGG + Intronic
906833804 1:49061391-49061413 ATGGAGCAATGGACTGGGCTTGG - Intronic
907246043 1:53109806-53109828 ATGGTGGGCAGCCCTGGGGTGGG + Intronic
907247394 1:53116801-53116823 AAGGAGGACAGGCCTGGGTCTGG - Intronic
907408974 1:54271633-54271655 ATGCAGCACAGGCATGGGGTTGG - Intronic
907482653 1:54755248-54755270 CCGGAGGAAGGGGCTGGGGTGGG - Intergenic
908202966 1:61816697-61816719 GTGGATGAGAGGACTGGGGTGGG - Intronic
909406429 1:75295525-75295547 ATGGAGGAAGAGACTGGGCTGGG + Intronic
910387216 1:86698118-86698140 TTGGAGGAAAGGGTTGGTGTGGG - Intergenic
910437015 1:87215626-87215648 ATGCAGGAGAGGCCAGGTGTAGG + Intergenic
911090886 1:94016032-94016054 AGGGAGGTAGGGCATGGGGTGGG - Intronic
911274770 1:95848239-95848261 ATGTAGGAAGGGACTGTGGTTGG - Intergenic
911948601 1:104142689-104142711 ATGAGGGCAAAGCCTGGGGTGGG - Intergenic
912795166 1:112688945-112688967 ATGGAGGAGAAGCCAGGGGCGGG - Exonic
913613781 1:120535238-120535260 GTGGAGGAAAGGCAGGGGGAAGG + Intergenic
914373007 1:147047088-147047110 GTGGAGGAAAGGCAGGGGGAAGG + Intergenic
914576488 1:148975644-148975666 GTGGAGGAAAGGCAGGGGGAAGG - Intronic
914841827 1:151254868-151254890 AGGCAGGGAGGGCCTGGGGTGGG + Intronic
914876937 1:151519085-151519107 TTGGAGGCCAGGCCCGGGGTCGG + Exonic
915532225 1:156509302-156509324 TTTTAGGAAAGGCCTGTGGTAGG - Intergenic
916242178 1:162651110-162651132 TTGGAGGAGAGACCTGGGGCAGG - Intronic
917470077 1:175319032-175319054 AAGGAGGTAGGGCATGGGGTTGG - Exonic
919537873 1:198810865-198810887 ATGTATGGAAGCCCTGGGGTGGG - Intergenic
919560825 1:199116044-199116066 ATAGAAGAAAGTCCTGGAGTGGG - Intergenic
919700862 1:200629784-200629806 CTGGAGGAGGGGCCTGGGTTTGG + Intronic
919796860 1:201326075-201326097 ATGTGTGAGAGGCCTGGGGTGGG + Intronic
919979482 1:202633453-202633475 ATGGAAGGGAGGCCTAGGGTGGG + Intronic
920335266 1:205241120-205241142 AAGGAGGGAAGGACTGGGGGTGG + Intronic
921512051 1:216043938-216043960 ATGGAGGATAGGATTAGGGTAGG - Intronic
922153262 1:223022695-223022717 AGGGAGGAAGCGCCTGGGGCTGG - Intergenic
923139999 1:231153104-231153126 CTGGAGGTGAGGCCTGGGGGTGG - Intergenic
1062847259 10:717692-717714 AGGGTGGAGAGGCCTGGGGCGGG - Intergenic
1063578583 10:7284307-7284329 AGGGAGGAAAGGGAAGGGGTGGG - Intronic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063828069 10:9921181-9921203 ATGGAGGGAAGGACTGGGGTAGG - Intergenic
1064103848 10:12484952-12484974 TTACAGAAAAGGCCTGGGGTAGG - Intronic
1065072282 10:22038236-22038258 AAGGAGGAAAAGCAAGGGGTGGG - Intergenic
1065174163 10:23061021-23061043 GTGGAGGAGAGGTGTGGGGTGGG - Intergenic
1065332673 10:24618887-24618909 ATGGAGAACAGATCTGGGGTGGG + Intronic
1065483293 10:26215228-26215250 AGAGAGGAAAGGGCTGAGGTCGG - Intergenic
1066010830 10:31192054-31192076 TTGGAGGAAAGCCCTGCTGTGGG - Intergenic
1067534602 10:47099716-47099738 GTGGAGGGAAGCCCAGGGGTGGG - Intergenic
1067539648 10:47142273-47142295 ATGCAGGAAGGCCCTGGGGTGGG - Intergenic
1067540469 10:47147380-47147402 ATAGAGGAAAAGCCTGGCCTTGG + Intergenic
1067844761 10:49710852-49710874 AAGGAGGGAAGGGCTGGGCTGGG - Intergenic
1068904494 10:62307713-62307735 ATGCTGGAAAGAACTGGGGTAGG - Intergenic
1069546042 10:69329729-69329751 AAGGAGGGAAAGACTGGGGTGGG + Intronic
1069701614 10:70430835-70430857 ATGTAAGAAAGTCCTGGGGTGGG + Intergenic
1070932126 10:80268499-80268521 TGGGATGAAAGGCATGGGGTGGG - Intergenic
1071025058 10:81102742-81102764 ATGGAGGAAAAAAGTGGGGTTGG - Intergenic
1072609131 10:97004958-97004980 CTGGAGGAATGGCCTTGGGGAGG - Intronic
1072658810 10:97349490-97349512 ATGAAGGGAAGGGCTGGGCTGGG - Intergenic
1072926859 10:99623358-99623380 TTGGAGGAATGGGTTGGGGTGGG - Intergenic
1073528356 10:104207258-104207280 CTGGAGAAAAGGGTTGGGGTGGG + Intronic
1074459069 10:113620663-113620685 GTGGATGAAAGGCATGGGCTGGG - Exonic
1074481034 10:113820833-113820855 ACGAAGGAAAGGACTGGGGAAGG + Intergenic
1074534091 10:114316145-114316167 AAAGATGAAAGGCGTGGGGTGGG + Intronic
1074543667 10:114386150-114386172 ATGGAGAAAATGCCTATGGTAGG + Intronic
1075476287 10:122737312-122737334 ATGAGGGAAAGGCATGGGTTTGG + Intergenic
1075738543 10:124679201-124679223 ATGGAAGCAAGGCTTGGAGTTGG - Intronic
1076356427 10:129857027-129857049 GTGGGGGAAGGGCCTGGTGTGGG + Intronic
1076450086 10:130551275-130551297 AAGGAGGAAAGGGGTGGGGCGGG - Intergenic
1076638580 10:131899473-131899495 GTGGAGGGGAGGCCAGGGGTTGG - Intergenic
1076798672 10:132810852-132810874 AGGGAGGAGGGACCTGGGGTCGG - Intronic
1076857092 10:133122734-133122756 AGGGAGGCACGGCCAGGGGTGGG - Intronic
1077166052 11:1139342-1139364 CTGCAGGGAAGCCCTGGGGTGGG + Intergenic
1078144638 11:8714458-8714480 AGGGAAGAAAGGTCTGGGATGGG - Intronic
1078854471 11:15195724-15195746 CAGGGGGAAAGGCCTGGGTTGGG + Intronic
1079122016 11:17692734-17692756 ATGCGGGAAAAGCCAGGGGTAGG + Intergenic
1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG + Intronic
1083095094 11:60242163-60242185 AAGGGGGAAAGGCCTGGGCTAGG + Intronic
1083098774 11:60281493-60281515 AAGGGGGAAAGGCCCGGGCTAGG - Intronic
1083889614 11:65589405-65589427 AGGGAGGAAAGGCCTGGGCTGGG + Intronic
1084238873 11:67805521-67805543 ATGAGGGCGAGGCCTGGGGTAGG + Intergenic
1084288808 11:68148556-68148578 AAGGAGGAGAGGCCCGGGGGTGG + Intergenic
1084322344 11:68380633-68380655 CTGGAGGATAGGGCTGGGCTCGG + Intronic
1084593694 11:70105002-70105024 CTGGAGGAGAGGGCTGGGCTTGG - Intronic
1084833554 11:71787318-71787340 ATGAGGGCGAGGCCTGGGGTAGG - Intergenic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1084950547 11:72662913-72662935 CTGGAGGAAGGGCCTGGCGGTGG - Intronic
1085345760 11:75767428-75767450 ATGGAGGGAAGGCCTGATCTAGG - Intronic
1085787791 11:79470292-79470314 CTTGGGGAAATGCCTGGGGTGGG - Intergenic
1086442980 11:86847314-86847336 AGGGTGGCAAGGCCTGGGTTGGG - Intronic
1086902588 11:92384508-92384530 ATGGGGCAAAGGGCTGGGGGAGG - Intronic
1087152211 11:94869257-94869279 ATGGAGGACAGTGCTGAGGTGGG - Exonic
1088813179 11:113405123-113405145 CAGGAAGAAGGGCCTGGGGTTGG - Intergenic
1088942456 11:114473946-114473968 ATGGAAGAGAAGGCTGGGGTGGG + Intergenic
1089616655 11:119698599-119698621 ATGGTGGACAGACCTGGGGCTGG + Intronic
1089747300 11:120626302-120626324 ATGGAAGAAAGGCCAGGGAAGGG + Intronic
1089874706 11:121708923-121708945 ATGGACCAAAGGCCAGAGGTAGG - Intergenic
1089931918 11:122321425-122321447 CTGGAGAAAAGACCTGAGGTGGG + Intergenic
1089982060 11:122780698-122780720 ATGGAGGAAAGGCCTGCAGGCGG + Intronic
1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG + Intronic
1091635468 12:2193594-2193616 ATTGAGCAAGGGCCTTGGGTTGG + Intronic
1092109125 12:5946302-5946324 ATGGAATAAAGGCCTGGGTTGGG - Intergenic
1092236945 12:6816297-6816319 ACTGAGGCAAGGCCTGGGGCAGG - Exonic
1092409565 12:8243154-8243176 ATGAGGGCGAGGCCTGGGGTAGG + Intergenic
1094360148 12:29621863-29621885 ATGGAGGGTAGGGGTGGGGTAGG - Intronic
1096191831 12:49624336-49624358 ATGGAGGCGAGGCCTTGGGCTGG + Intronic
1098209802 12:68151711-68151733 GTGGAAGAATGGCCTGGAGTAGG - Intergenic
1098268748 12:68750044-68750066 AGGCAGGAAGGGCCTGGGCTAGG + Intronic
1099767809 12:87011896-87011918 AGAGAAGAAAGGCCTGAGGTAGG - Intergenic
1101965092 12:109276949-109276971 GTGGAGGCCAGGCATGGGGTAGG - Intergenic
1101990028 12:109477099-109477121 TTAGGGGAAAGGCCCGGGGTGGG - Intronic
1102231519 12:111265789-111265811 ATGGGGGAAAGGACTGGGAGAGG - Intronic
1102252219 12:111394969-111394991 ATGGAGGATGGGGGTGGGGTGGG + Intergenic
1103019475 12:117522396-117522418 ATGGAGAGAAGGCCAGGGGTGGG + Intronic
1103045821 12:117733723-117733745 AGAGGGGAAAGGGCTGGGGTAGG - Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103359046 12:120342826-120342848 ATGGACCAGAGGGCTGGGGTGGG + Exonic
1103515803 12:121507537-121507559 ATGTAGAGGAGGCCTGGGGTAGG - Intronic
1103605915 12:122086080-122086102 ATGGAGGAAAGCCACGGGATTGG + Intronic
1104386803 12:128357837-128357859 ACGGAGGGGAGGCCTCGGGTGGG - Intronic
1106585938 13:31056122-31056144 TTGGAGGAAAGGGCTTTGGTGGG - Intergenic
1108116982 13:47139681-47139703 ATGCATGAATGCCCTGGGGTTGG + Intergenic
1108534534 13:51360318-51360340 ATGGAGGAGAGGGGTGGGATGGG + Intronic
1109210563 13:59530662-59530684 GTGCAGGAAAGGCCTGTTGTAGG + Intergenic
1111123623 13:83883824-83883846 TTGGGGGAAAGGACTGGGGTTGG + Intergenic
1111401713 13:87745939-87745961 ATGGAGGAAAAGCCAGTAGTAGG - Intergenic
1113055328 13:106260833-106260855 CTGCAGAAGAGGCCTGGGGTGGG - Intergenic
1113074899 13:106458596-106458618 ATGCACAAAATGCCTGGGGTGGG + Intergenic
1114472532 14:22973665-22973687 CTGGAAGAAAGGGATGGGGTGGG + Intronic
1115407063 14:33029088-33029110 GTAGAGGAAAGGCCTGGAGTGGG + Intronic
1116326294 14:43536363-43536385 AGGGTGGCAAGGCCTGGGTTGGG - Intergenic
1117160513 14:52984920-52984942 AAGGAGGAAGGCCCTGTGGTAGG + Intergenic
1119380403 14:74224652-74224674 CTGGAGGGAAGGACTGTGGTAGG - Intergenic
1119543826 14:75457620-75457642 GTGCAGGAAAGGCCTGGGGCTGG + Intronic
1119986890 14:79148344-79148366 CTAGAGCAAAGGCCTGAGGTGGG + Intronic
1120825896 14:88955035-88955057 GGGGAGGAAAGACCTAGGGTTGG - Intergenic
1120845218 14:89119307-89119329 TTGGAGGACAGGGCTGGGGTGGG + Intergenic
1121115903 14:91342559-91342581 ATGAAGGAGAAGCCCGGGGTGGG - Intronic
1121250210 14:92493700-92493722 ATGCAGGAGAGACCTGTGGTGGG - Exonic
1121319263 14:92981534-92981556 ATGGGAGATAGGCCTGGGGCAGG - Intronic
1122341622 14:101032150-101032172 AAGGAGAAAAGACATGGGGTAGG - Intergenic
1122357504 14:101132417-101132439 ATGGAGTCAAGGCCTGGGGTGGG + Intergenic
1122457421 14:101865132-101865154 GTGTAGGAAAGGCCTGAGGTGGG + Intronic
1124167145 15:27338348-27338370 ATGGAAAGAATGCCTGGGGTGGG - Intronic
1124495088 15:30181426-30181448 ATGGAAGGGAGGCCTAGGGTGGG + Intergenic
1124639190 15:31384958-31384980 AAGGAGGTAAGGCCTTGGGGAGG + Intronic
1124748481 15:32357219-32357241 ATGGAAGGGAGGCCTAGGGTGGG - Intergenic
1125745902 15:41997021-41997043 ATGGAGGTGGCGCCTGGGGTAGG + Intronic
1126795553 15:52258011-52258033 ATGGAAGCAAGGCCAGGGCTGGG + Intronic
1128554988 15:68625458-68625480 ATGCTGGCAAGGCCTGGGGGTGG - Intronic
1128870406 15:71151054-71151076 ATGGAGAAAAGGGCTGGGCTGGG + Intronic
1129051626 15:72785998-72786020 AAAGAGGAAAGGGCTGGGCTGGG + Intergenic
1129665984 15:77579636-77579658 ATGCAGGGAAGGATTGGGGTGGG - Intergenic
1129708016 15:77805708-77805730 ATGGAGGAAATGCATGGAGCTGG - Intronic
1130110634 15:80960926-80960948 AGGAAGGAAAGTCCTGGGTTAGG + Intronic
1130114285 15:80992841-80992863 TAGGAGGAGAGGCCTGGGGATGG + Intergenic
1130301325 15:82681343-82681365 ACTTAGGAAAGGCCAGGGGTGGG + Intronic
1130567394 15:85008417-85008439 ATGGAGGAAGGGTCTGGTGAGGG - Intronic
1130573977 15:85074149-85074171 ATGCAGAATAGGCCAGGGGTAGG - Intronic
1130675778 15:85950712-85950734 AAGCAGGAAAGGCCTGGGACAGG - Intergenic
1130894360 15:88158783-88158805 GTGGAGGCCAGGCCTGGCGTGGG + Intronic
1131076573 15:89499112-89499134 AGGGAGACAAGGGCTGGGGTGGG + Intergenic
1131179033 15:90227877-90227899 AGGCAGAAAAGGCATGGGGTAGG - Intronic
1131439526 15:92448402-92448424 GTGGAGGAATGGGCTGGGGAGGG + Intronic
1132289268 15:100688167-100688189 ATTGAGGAGAGTCCTGGGGCAGG + Intergenic
1132645976 16:999476-999498 ACGGAGGAACAGCCTGGGGATGG - Intergenic
1132711692 16:1271707-1271729 ATGGGTGAAGGGCCTGGGGACGG + Intergenic
1132711715 16:1271791-1271813 ATGGGTGAAGGGCCTGGGGATGG + Intergenic
1132741216 16:1414366-1414388 AGGGAGGAACGCCCCGGGGTTGG - Intronic
1132847353 16:2006665-2006687 CTGGGGGAGATGCCTGGGGTGGG + Intronic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1132995414 16:2820051-2820073 ATTGAGGCACAGCCTGGGGTTGG - Intronic
1133103140 16:3491224-3491246 ATGCAGGCATGGCCCGGGGTGGG - Intergenic
1135154246 16:20038659-20038681 ATGTAGGAGATCCCTGGGGTGGG + Intronic
1135294775 16:21269773-21269795 AAGGAGGTAAGTCCAGGGGTGGG - Exonic
1135565879 16:23510543-23510565 GTGGAGGGGGGGCCTGGGGTGGG - Intronic
1135993038 16:27229035-27229057 GTGGTGGGAAGCCCTGGGGTGGG - Intronic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136596417 16:31253226-31253248 AGAGAGGTAAGGGCTGGGGTTGG + Intergenic
1137896045 16:52213933-52213955 CTGGAGGCAGGGCCTGGTGTAGG + Intergenic
1140447011 16:75037666-75037688 TTGGAGAGAAGGTCTGGGGTGGG - Intronic
1140778451 16:78272331-78272353 ATGCAGGAAAGGCCATGTGTAGG - Intronic
1141435778 16:83999011-83999033 ATGGAAGAAAGCCCTGGGAAGGG - Intronic
1141633423 16:85301344-85301366 ATTGAGGAAGGCCCTGGAGTGGG + Intergenic
1142161731 16:88561317-88561339 GGGGAGGAAAGGCCCGGGGTAGG - Intergenic
1142212198 16:88813482-88813504 CTGGAGGAGGGGCCTGGGGAGGG + Intergenic
1142523067 17:518611-518633 ATGGAGGAAGGGGCTGGGCTCGG + Exonic
1143020712 17:3916031-3916053 CTGGAGGACAGGCCCGGGGTAGG + Intronic
1143139575 17:4733737-4733759 ATGCAGGAGAGGGCTGAGGTGGG + Exonic
1143475787 17:7203334-7203356 ATGGAGGGGAGGCCAGAGGTGGG + Intronic
1143503319 17:7351265-7351287 AGGGAGGAAAGGCCGGGAGGCGG - Intronic
1143637481 17:8174433-8174455 ATGGAGGAAAGGGCTGGGTAGGG + Intronic
1143705275 17:8693434-8693456 ATGGAGGGGAGGTCTGGGCTAGG - Intergenic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144022098 17:11246559-11246581 ATGGAGGAAGGGCTAGGGGAAGG + Intronic
1144213008 17:13031193-13031215 AGGGAGGGAAGGAGTGGGGTAGG - Intergenic
1144844107 17:18207027-18207049 AGGGTGGAGAAGCCTGGGGTAGG + Intronic
1144956942 17:19023453-19023475 ATGCTGGCAAGGCCTGGGGCTGG - Intronic
1146178764 17:30684013-30684035 AGGGAGGAAAGGGATGGGGCTGG + Intergenic
1146290115 17:31600734-31600756 ATGGAGGACTGGAGTGGGGTAGG - Intergenic
1146605210 17:34252043-34252065 CTGGAGGAGAGGCCTTGAGTGGG + Intergenic
1146928602 17:36762156-36762178 CTGGGGGAAAGGGGTGGGGTGGG + Intergenic
1147267675 17:39244625-39244647 ATGGAGCAAAGGGCAGGGCTGGG + Intergenic
1147535231 17:41316436-41316458 GTCAAGGAAAGGCCTGGGGCTGG - Intergenic
1148897632 17:50849030-50849052 TTGGAGGAGAGGCCTGGTGGGGG - Intergenic
1149358618 17:55869871-55869893 ATGAAGGGAAAGCGTGGGGTTGG - Intergenic
1150480308 17:65503993-65504015 ATGCAGGGAAAGCCTGGGGATGG + Intergenic
1150612084 17:66741500-66741522 ATGGAGGGAGGACCGGGGGTTGG + Intronic
1150930680 17:69581481-69581503 CTGGAGGGAAGGCGTGGGGAGGG - Intergenic
1151546019 17:74793639-74793661 GTGGAGGAAAGGCTGGGAGTGGG + Intronic
1151800384 17:76375989-76376011 AAAGAGGAAAGGGGTGGGGTGGG + Intronic
1151971554 17:77460074-77460096 TTGGAGGTAAGGCCTGGGGGGGG - Intronic
1152015637 17:77748680-77748702 ATGGAACCAAAGCCTGGGGTGGG - Intergenic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152387967 17:79986512-79986534 CTGGTGGAAGGTCCTGGGGTAGG - Intronic
1152419100 17:80182557-80182579 ACGGGGGAGAGGCCTGGGGCTGG - Intronic
1152757943 17:82094884-82094906 AGGGTTGAAATGCCTGGGGTGGG + Intronic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1153267613 18:3286428-3286450 TTGGAGGAAAGGCCTGGTTGGGG - Intergenic
1153515899 18:5900957-5900979 GTGGAGGAAAGGGATAGGGTGGG + Intergenic
1153953356 18:10075753-10075775 AAAGCAGAAAGGCCTGGGGTGGG - Intergenic
1155142115 18:23053230-23053252 ATGGAAGACAGACCTGGGTTAGG - Intergenic
1155336401 18:24769691-24769713 ATTGAGGCAATGCTTGGGGTTGG - Intergenic
1155506123 18:26535087-26535109 TGGAGGGAAAGGCCTGGGGTTGG + Intronic
1156217003 18:35009677-35009699 ACGGAGGATAGGCCTGGGATCGG + Intronic
1156648859 18:39200474-39200496 TTGGAGGAAAGGCTTGGGTAGGG + Intergenic
1157493168 18:48137867-48137889 TTGAAGGAAAGGCCTGGGAGAGG - Intronic
1159025685 18:63180531-63180553 ATGGAGATTAAGCCTGGGGTGGG - Intronic
1159206122 18:65255241-65255263 ATCCAGGAAAGGCCTGGAATGGG - Intergenic
1160786033 19:900645-900667 ATGGGGGCGAGGCCTGGGGTGGG - Intronic
1160786081 19:900762-900784 ATGGGGGCGTGGCCTGGGGTGGG - Intronic
1161110920 19:2469549-2469571 TTGTAAGACAGGCCTGGGGTGGG - Intergenic
1161258612 19:3323333-3323355 GTAGAGGAAAGGACTTGGGTGGG - Intergenic
1161447461 19:4326686-4326708 GTGGAGGAAAAACCTGGGCTCGG - Intronic
1161497676 19:4596470-4596492 AGGGAGGAGGGGCCTGGGGGGGG + Intergenic
1161611181 19:5243884-5243906 AGGGAGGTGAGGCGTGGGGTCGG - Exonic
1161619647 19:5291335-5291357 ATGGAGGAGGGGGCTGGGCTGGG + Intronic
1161816525 19:6502662-6502684 ACTGAGGCAAGGCCTGGGGCGGG - Intronic
1162068961 19:8142429-8142451 AGGGAGGATAGGCCTGGGGAAGG - Intronic
1162271712 19:9621355-9621377 GTGCAGAAAGGGCCTGGGGTTGG + Exonic
1163093340 19:15036451-15036473 GTGGAGAAAGGGCCTGGGGCAGG + Intergenic
1163324599 19:16595064-16595086 AGGGAGGAAGGATCTGGGGTTGG - Intronic
1163767742 19:19172652-19172674 ATGGAGGAGAAGGCTAGGGTGGG + Intronic
1164621814 19:29700595-29700617 ATGGGGGACAGGGCAGGGGTGGG - Intronic
1164675217 19:30096033-30096055 ATGGAGGGAAGGGGTGGGGGTGG + Intergenic
1166016131 19:39980606-39980628 ATGGGGTAAATGCCTGGGGCTGG - Intronic
1166392900 19:42419717-42419739 ATGGAGGAAGGGCCAGGTGTGGG + Intronic
1166549418 19:43655402-43655424 ACACAGGCAAGGCCTGGGGTCGG - Intronic
1166975340 19:46602107-46602129 TGGGAGGAAGAGCCTGGGGTGGG + Intronic
1168241155 19:55089508-55089530 ATGGAGAACAGGCTGGGGGTTGG - Intergenic
1168570673 19:57466357-57466379 CAGGAAGAAAGGCCTGGGATCGG + Intronic
1168585217 19:57586270-57586292 ATGCAGGAAAGGGCTGGGTGTGG + Intronic
925750960 2:7090289-7090311 TCTGAGGAAAGGCCTGGGGCAGG + Intergenic
926360188 2:12079558-12079580 AGGGAGCAAAGGCCGTGGGTAGG - Intergenic
927027079 2:19079503-19079525 ATGGTGGAATGGCCTTGGGGAGG - Intergenic
927336809 2:21934383-21934405 ATGGTGGAGGGGCGTGGGGTAGG - Intergenic
927812785 2:26189353-26189375 ATGGAGGACACGGATGGGGTGGG - Exonic
927929183 2:27033191-27033213 CTGCCGGACAGGCCTGGGGTAGG - Intronic
928180477 2:29065121-29065143 ATGGAGGACAGGGGTGGGGCAGG - Intronic
928297514 2:30097222-30097244 ATGGAGGAAAGGTCAGGTTTGGG - Intergenic
928752357 2:34485727-34485749 CTGGAGCAAAGGCCTGGAGTAGG - Intergenic
929420485 2:41785125-41785147 AGGGAGGAAAGCTCTGGGCTGGG - Intergenic
929453847 2:42053123-42053145 CTGAAGCAAAGGCCTGGGGATGG + Intronic
929896622 2:45966628-45966650 ATTGAGGAAAACCCTGGGGTTGG - Intronic
929996985 2:46834147-46834169 ACGTATGCAAGGCCTGGGGTGGG - Intronic
930200639 2:48549350-48549372 ATGGAGTCCAGGCCTGGGGTGGG + Intronic
931570645 2:63665765-63665787 ATGGAGGAAGGGCTTAGGGGAGG + Intronic
931637747 2:64355831-64355853 ATGGAGGAAAGGTGTGGTGCAGG + Intergenic
932101219 2:68900873-68900895 TGGGAGCAAAGGCCTGGGGTAGG - Intergenic
932345552 2:70993127-70993149 CTGCAGGAAAGGCTGGGGGTAGG - Intronic
932446209 2:71783067-71783089 CTGGTGGCAAGGGCTGGGGTGGG - Intergenic
932743876 2:74314992-74315014 AAGGAGGAGAAGGCTGGGGTAGG - Exonic
933686837 2:85148205-85148227 ATGCAGGAAGGGGCTGGGATGGG + Intronic
933804528 2:85988558-85988580 CTTGTGGAAATGCCTGGGGTGGG - Intergenic
934606854 2:95701944-95701966 AAGGTGGCAAGGCCAGGGGTAGG - Intergenic
935668956 2:105538989-105539011 ACGGAGGACAGGACGGGGGTGGG + Intergenic
935703788 2:105838759-105838781 GTGGATGAAAGGCCTACGGTCGG - Intronic
936084474 2:109456995-109457017 ATGGAGGGTGGACCTGGGGTCGG + Intronic
936286263 2:111183641-111183663 AGGTAGGAAAGGGCTTGGGTGGG - Intergenic
936540247 2:113344067-113344089 AAGGTGGCAAGGCCAGGGGTAGG - Intergenic
936924525 2:117722791-117722813 ATGGAAGGAAGGCATGGGGATGG + Intergenic
937039359 2:118808885-118808907 AGTGAGGACAGGCCTGGGGAGGG + Intergenic
937087477 2:119181068-119181090 ATGGAGGGAAGGCCTTGGGGCGG - Intergenic
937097998 2:119248210-119248232 AGGGAGGAAGGGCATGGGGTGGG - Intronic
938245718 2:129776398-129776420 ATCTAGGAAAGGCCTGGGTCTGG - Intergenic
938288176 2:130135893-130135915 AGTGAGGACGGGCCTGGGGTGGG + Intergenic
938321516 2:130369234-130369256 AGGGTGGAAAGGCTTTGGGTTGG + Intronic
938459764 2:131490035-131490057 CTGAAGGACAGGCCTGGAGTAGG - Intronic
938959962 2:136331912-136331934 ATGGAGTAAATGCCTGCAGTGGG - Intergenic
938965151 2:136381646-136381668 AGGGAGGAAAGGCCTGGTGGGGG + Intergenic
940024567 2:149192517-149192539 GTGGAGGAATGGCCTGGGATTGG + Intronic
940076434 2:149747294-149747316 GTGAAGGCAAGGCCTGGAGTAGG + Intergenic
940246135 2:151618433-151618455 ATGGATGAAAGGCATTGGCTGGG - Exonic
940887447 2:159001892-159001914 ATGGAGGGAGGACCTGGGATAGG + Intronic
942280992 2:174363898-174363920 ATTGGGGAAGGGCCAGGGGTGGG - Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
945227075 2:207542850-207542872 ATAAAGGGAAGGCCTGAGGTAGG - Intronic
946194215 2:218023478-218023500 ATGGAGGAGAGCCCTGGGCTTGG - Intergenic
946681614 2:222222699-222222721 ATGGAGGAAAGCACTGTGTTTGG + Intronic
947291202 2:228576467-228576489 ATGGTGGAAATGATTGGGGTAGG + Intergenic
947505284 2:230703865-230703887 CGGGAGGCAAGGCCTGGAGTAGG + Intergenic
947535091 2:230935064-230935086 TCAGAGGAAACGCCTGGGGTGGG + Intronic
947701405 2:232237669-232237691 ATGGAGGAAATGGTTGGGGGCGG + Intronic
948234029 2:236373949-236373971 GTGGAGGAAGGCACTGGGGTGGG + Intronic
948610616 2:239164002-239164024 AGGGAGGGAAGGGCTGGGGACGG + Intronic
948704013 2:239778305-239778327 ATGGAGGGAAGACCTGGATTTGG + Intronic
1168967122 20:1905489-1905511 ATGGGGGAAATGCATGGGTTAGG - Intronic
1169191158 20:3660053-3660075 AGGCATGAAGGGCCTGGGGTGGG - Intronic
1169524447 20:6408223-6408245 TTGGAGGTGGGGCCTGGGGTGGG + Intergenic
1170448443 20:16455881-16455903 ATGGAGGAAAGGGCTGGAAAGGG - Intronic
1170903502 20:20489019-20489041 ATGCATGAAAGGCCAGGGGAAGG + Intronic
1171312022 20:24152180-24152202 AGGGAGCACAGGCATGGGGTTGG - Intergenic
1172193774 20:33078110-33078132 ATGGAGGTAGGACCTGGGTTGGG + Intergenic
1172208555 20:33181735-33181757 ATGGAGGAAAGTGCTGGGTGGGG - Intergenic
1172227829 20:33317009-33317031 ACTCAGGAAAGGCCAGGGGTGGG + Intergenic
1172264185 20:33596712-33596734 GTGGAGCTGAGGCCTGGGGTGGG - Intronic
1173229671 20:41184284-41184306 ATGGAAAAAAGACATGGGGTAGG - Exonic
1173570320 20:44071629-44071651 AAGGAGGAAGGCCCTGGAGTGGG - Intergenic
1173660718 20:44731693-44731715 ATGGAGGAATGGCCAGGCCTGGG - Intergenic
1173868412 20:46327543-46327565 ATGGAGGAAAGGCAGGTGTTGGG + Intergenic
1173924134 20:46768238-46768260 GTGGAGGAAAGCCATGGGGACGG - Intergenic
1174404737 20:50295953-50295975 GACGAGGAAGGGCCTGGGGTGGG - Intergenic
1174410120 20:50329970-50329992 ATGGAGGCCAGGCCCTGGGTTGG - Intergenic
1174416901 20:50373423-50373445 ATGGAGGAAAGGGCTGGGTGTGG + Intergenic
1174534913 20:51243843-51243865 TTGGAGGTAAGGCCTGGTGGGGG - Intergenic
1174918673 20:54679430-54679452 AAGGAGCAGAGGCCTGGGCTGGG + Intergenic
1175432001 20:58911876-58911898 ATGGGGGAAGGGCCTGGGTCAGG + Intergenic
1176020799 20:62961483-62961505 ATCGAGGCCAGGCCAGGGGTGGG + Intronic
1176361231 21:5998415-5998437 ATGGCAGAGAGGCCTGGAGTGGG + Intergenic
1176624771 21:9083517-9083539 CTGGAGGAATGGCCTCGGGGTGG + Intergenic
1176678257 21:9801178-9801200 GTGTAGGAAAGGCTTGGTGTAGG + Intergenic
1176678260 21:9801194-9801216 GTGTAGGAAAGGCTTGGTGTAGG + Intergenic
1177007819 21:15695757-15695779 ATGGGGGAAACTCCTGTGGTGGG + Intergenic
1177787311 21:25685135-25685157 TTGAAGTAAAGGCCTGGAGTGGG + Intronic
1178327407 21:31657174-31657196 AAGGAGGAAAGGCCAGGGGCGGG - Intergenic
1178760359 21:35396270-35396292 AGGGAGGAAAGTCCTGGGAATGG + Intronic
1179762287 21:43540135-43540157 ATGGCAGAGAGGCCTGGAGTGGG - Intronic
1180195198 21:46189922-46189944 ATGGATGTAGGGCTTGGGGTGGG - Exonic
1180872087 22:19151876-19151898 ATGAAGGAATGGCCAGGGCTAGG - Intergenic
1181777970 22:25173228-25173250 TTGGAGGAAGGGCCTGGTGGGGG - Intronic
1181804281 22:25365695-25365717 CTGGAGGACAGGGCTGGGCTCGG - Intronic
1182315201 22:29441478-29441500 GTAGAGGAGAGGCATGGGGTTGG + Intronic
1182754307 22:32666486-32666508 AAGGACGAAGGGCCTGAGGTGGG - Intronic
1182801478 22:33035093-33035115 CTGAAGGAAAGGAGTGGGGTGGG + Intronic
1183105256 22:35610832-35610854 ATGCGGGGAAGGCCTCGGGTGGG - Intronic
1183314362 22:37128852-37128874 GTGGGAGAAAGGCCAGGGGTGGG + Intronic
1183481718 22:38068959-38068981 ATGGAGGTAAGGCTGGGGGCAGG + Intronic
1183608266 22:38879761-38879783 AAGGATCAAGGGCCTGGGGTGGG - Intergenic
1183714766 22:39527234-39527256 GTGGGGAAAAGGGCTGGGGTGGG - Intergenic
1183811726 22:40263364-40263386 AGGAAGGAAAGGCCATGGGTAGG - Intronic
1183829190 22:40409037-40409059 TTGGAGGAGAGCCCTGGAGTGGG + Intronic
1184648885 22:45910603-45910625 CTGGCAGGAAGGCCTGGGGTGGG + Intergenic
1185239891 22:49736942-49736964 GTGGGGGACAAGCCTGGGGTGGG - Intergenic
949728570 3:7079620-7079642 ATCAAGGAAAGGACTGGAGTGGG + Intronic
950112984 3:10432395-10432417 ATTTAGGAAAGCCCTGGGGCAGG + Intronic
950165549 3:10794734-10794756 ATTGTAGAAAGGCCTGGGCTAGG - Intergenic
950444707 3:13029910-13029932 ATGGAGGAAAGCCATGGAGCAGG - Intronic
951102935 3:18710338-18710360 ATGGAGGAAAGGCCATGCATGGG - Intergenic
952871249 3:37903171-37903193 ATGGAGGAGAGGACTTGGGAAGG + Intronic
953465567 3:43116400-43116422 ATAGAGCAAAGGCCAGGGGAAGG + Intergenic
953608705 3:44429279-44429301 ATGTAGGAAAGCTCTGGGGCTGG - Intergenic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
957916659 3:86695216-86695238 AGGGTGGCAAGGCCTGGGTTGGG + Intergenic
959630869 3:108506105-108506127 GTGGAGGAAAGTGTTGGGGTTGG - Intronic
960299989 3:115991052-115991074 ATGGAGGCATAGCCGGGGGTCGG - Intronic
960995303 3:123336490-123336512 ATGCAGCAAAGGCCTGGCTTTGG + Intronic
961300031 3:125916393-125916415 ATGAGGGCGAGGCCTGGGGTAGG - Intergenic
961338946 3:126204438-126204460 TTGGAGGAAAGGCCTGGTGCGGG - Intergenic
961383046 3:126508368-126508390 CTAGAGGAAAGGCCAGGGGTGGG + Intronic
961433610 3:126901008-126901030 TTGGAGGTAGGGCCTGGGGGGGG - Intronic
961446969 3:126985464-126985486 GAGGAGCAAAGGCCTGGGGTGGG - Intergenic
961537104 3:127576940-127576962 AGGGAGGCCTGGCCTGGGGTGGG - Intronic
962976539 3:140451000-140451022 ATGGAGGAGAGGACTGGAGGTGG - Intronic
963007599 3:140740624-140740646 AAGGAGGAGAGGCCTGGAGTGGG + Intergenic
964434281 3:156635687-156635709 ATGGAGGAAAGGCAGAGGGAGGG - Intergenic
965698553 3:171436113-171436135 ATGGAGGGAAGGTCAGGAGTGGG - Intronic
965801252 3:172496508-172496530 CTGGAGGAAAGGACTGCTGTGGG - Intergenic
966412414 3:179657225-179657247 AAGGAGGAAAGGCCGGGGCGCGG + Intronic
966933672 3:184691803-184691825 ATGGGGGAAAGGCAGGGGTTGGG - Intergenic
968131355 3:196194566-196194588 ATGGAGGAAAGGCGTGGAGATGG + Intergenic
968581443 4:1397181-1397203 AGGGAGGAAGGGGCAGGGGTGGG - Intergenic
968742406 4:2337946-2337968 TTCAAGGGAAGGCCTGGGGTAGG - Intronic
969343638 4:6557951-6557973 GAGGAGGAGAGGTCTGGGGTGGG - Intronic
969525349 4:7701425-7701447 CAGGAGGAAACGCCTGGGGAAGG + Intronic
969599442 4:8167248-8167270 TTGGAGGCAGGACCTGGGGTTGG - Intergenic
971751380 4:30653963-30653985 ATGGATGAATGGCAGGGGGTTGG + Intergenic
974065885 4:57076676-57076698 AAGGAAGAGAAGCCTGGGGTGGG + Intronic
974968872 4:68801702-68801724 ATGGCGGCAAGGCCTGGGTCTGG - Intergenic
975625084 4:76337870-76337892 AAGGATCAAAGGACTGGGGTAGG - Intronic
976602886 4:86954615-86954637 GTGGGGTAAAGGCCTGAGGTGGG + Intronic
976779813 4:88746633-88746655 ATGGTGGAGGGGCCAGGGGTCGG - Intronic
977673555 4:99723103-99723125 TTGGTGTAAAGGCCTGAGGTGGG + Intergenic
978577223 4:110199196-110199218 GTGGAAGAAAGGGCTGGGTTAGG + Intronic
981240562 4:142471843-142471865 ATGGAGGAAGGGGCTGGTGAAGG - Intronic
982489609 4:156013585-156013607 AAGAAGGAAAGGTCTGGGCTCGG + Intergenic
983567013 4:169164015-169164037 AAGGAGGCAATGCCTGGGCTGGG - Intronic
984176831 4:176429368-176429390 AAGGAGGAAAGGCATGGAGAAGG + Intergenic
984206308 4:176792310-176792332 ATGGTGGAAGGACCGGGGGTGGG + Exonic
984707688 4:182859844-182859866 AGGGAGGGAAGGCCTGGAATAGG - Intergenic
986076268 5:4340869-4340891 ATGGTGGAAAAGTCAGGGGTGGG + Intergenic
986984685 5:13487156-13487178 ATGGAGGAAGGGCCTTTGGGAGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987578650 5:19760628-19760650 CTGGAGGACAGGCATGGGGATGG - Intronic
987855325 5:23413074-23413096 AAGGAGGAACTGCCTGGGGGAGG - Intergenic
988878232 5:35471978-35472000 ATGGAGGAAAGGACAGGTGGGGG - Intergenic
989157433 5:38357454-38357476 AAGGATGAAAGGCTTTGGGTGGG + Intronic
992218821 5:74551517-74551539 AAGGAGGAAATACCTGTGGTAGG - Intergenic
992395681 5:76367581-76367603 ATGGGAGAAAGACCTGGGTTTGG + Intergenic
992425183 5:76649758-76649780 ATGGAGGAGAAGTGTGGGGTTGG - Intronic
992557235 5:77915855-77915877 AGGGAGGAGAGGCCAGAGGTTGG + Intergenic
992630206 5:78672479-78672501 ATGGAAGAAAGGCTTTTGGTGGG - Intronic
993231797 5:85246689-85246711 ATGGAGGATATGCATGGGCTAGG - Intergenic
993852087 5:93023253-93023275 ATGAAGGAAAGGCCATGGGCAGG - Intergenic
995125389 5:108573400-108573422 ATGGAGAGAAGGGGTGGGGTGGG + Intergenic
996764406 5:127021220-127021242 ATGGAGGAAAGGGATGGAGTAGG + Intronic
998630600 5:143893799-143893821 ATGGAGGAATGCCATGGTGTGGG + Intergenic
998838965 5:146233105-146233127 ATTTAGCAAAGGCGTGGGGTAGG - Intronic
998902891 5:146874877-146874899 ATAGAGGAAGGGCCTTGGGTAGG - Intronic
999250497 5:150179687-150179709 CAGGAGGACAGGCCTGAGGTAGG - Intronic
1000010650 5:157228541-157228563 CTGGAGAAAAGGCTTGGGGTAGG + Intronic
1000040118 5:157479214-157479236 CTGGGGGAAAAGCCTGGGTTGGG - Exonic
1000179383 5:158793029-158793051 AAGAAGGTAAGCCCTGGGGTTGG + Intronic
1000331200 5:160206938-160206960 ATGGACGAAGGTCCTGGGGTAGG - Intronic
1000724691 5:164754739-164754761 ATGCTGGAAAGGCCTGGACTAGG - Intergenic
1001487698 5:172131372-172131394 ATGCAGGAACTGCCTGGGTTTGG - Intronic
1002082270 5:176744091-176744113 AGGGATGAAAGGCATGGGCTCGG + Intergenic
1002874897 6:1202035-1202057 ATGCAGGGTAGGCCTGGGGGCGG - Intergenic
1002891435 6:1336014-1336036 AATAAGGAAAAGCCTGGGGTAGG - Intergenic
1003258747 6:4496875-4496897 ACGAATAAAAGGCCTGGGGTGGG + Intergenic
1003322387 6:5063435-5063457 CAGGAGGATAGGCCTGGGGGAGG - Intergenic
1005013452 6:21357182-21357204 ATGGGGGAAGGGCCTGGAATAGG - Intergenic
1005401551 6:25439328-25439350 TTGGAGGAGAGGTCTGGAGTTGG + Intronic
1006047198 6:31308135-31308157 AGGGAGGAAGGAGCTGGGGTGGG - Intronic
1006116551 6:31778921-31778943 ATGGAGGAAGGGGATGGTGTGGG + Intronic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1006339003 6:33435702-33435724 AAGGAGGAGAGGCTTGGGGAAGG + Intronic
1006402014 6:33823123-33823145 CTGGACCAAAAGCCTGGGGTTGG - Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1006614984 6:35320012-35320034 GTGGAGGTGAGGCCTGGGGTGGG + Exonic
1006686951 6:35843261-35843283 ATGTAAGAAAGACCTGGGCTGGG - Intronic
1006741756 6:36313713-36313735 CTGGAAGAAAGGCCTGCGGCCGG - Intergenic
1007237782 6:40403415-40403437 AGGGACCAGAGGCCTGGGGTTGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008322374 6:50132603-50132625 ATGGAGGAAAAGCATCAGGTAGG - Intergenic
1012959619 6:105608847-105608869 CTGGAGGAGACGCGTGGGGTTGG + Intergenic
1013007345 6:106086222-106086244 CTGGGGGAAAGCCCTGGGCTCGG + Intergenic
1013396819 6:109748975-109748997 ATGGAGGCAAAGCTTGGGGTGGG + Intronic
1014492125 6:122075530-122075552 CTGGAGGGAAGGACTGGGGGTGG + Intergenic
1016310410 6:142727639-142727661 AAGGAAGAGAGGCCTGGTGTGGG + Intergenic
1016317757 6:142808706-142808728 ATGGAGGAAAGGATGGGGGAGGG + Intronic
1016543620 6:145195466-145195488 TTGGAGGAAGGGCCTGAGGGAGG - Intergenic
1016710742 6:147168856-147168878 AGGGAGGAAAGACTTGGGGATGG - Intergenic
1016934535 6:149439929-149439951 ATGGGGGAAAAGCAAGGGGTTGG - Intergenic
1017890612 6:158635606-158635628 ATGGAGACAAGGCGTGGGTTTGG + Intergenic
1018889593 6:167973822-167973844 ATGGAGGCATGGGCTGGGGTGGG + Intergenic
1019600806 7:1882770-1882792 ATGGAGGGCAGGCCTGGGTGTGG - Intronic
1020104784 7:5417674-5417696 AAGAAGGAAAGCGCTGGGGTTGG + Intronic
1022902541 7:34825155-34825177 AAGGAGAAAAGGCCTGGAGGTGG - Intronic
1023264763 7:38393377-38393399 ATGGAGGCAGGCCCTGGGGTTGG + Intronic
1023980772 7:45068763-45068785 ATGGGGGCAATGCCTGGGGCAGG - Intronic
1024243776 7:47454578-47454600 ATGGAGGAAAGGCCATGGGGAGG + Intronic
1024274670 7:47668080-47668102 ATGTAGCAAAGGCCAGGAGTAGG + Intergenic
1025827730 7:65024269-65024291 CTGGAGGAAAGGCCACAGGTGGG - Intergenic
1025915265 7:65860723-65860745 CTGGAGGAAAGGCCACAGGTGGG - Intergenic
1026456290 7:70575383-70575405 AAGGTGGAGAGGCCTGGGCTTGG - Intronic
1027130132 7:75584810-75584832 GAGGAGGAAGGGCCTAGGGTAGG - Intronic
1028871418 7:95774411-95774433 AGGGAGGAAAGGCTGGGGGTGGG - Intronic
1029176385 7:98667733-98667755 ATGTAGGGAAGAACTGGGGTTGG + Intergenic
1029339832 7:99933773-99933795 AGGAAGGAAAGGCCAGGGTTTGG + Intergenic
1029403734 7:100360661-100360683 ATGGAGGAATGGCCAGAGGTGGG + Intronic
1029408277 7:100390919-100390941 ATGGAGGAGTGGCCAGAGGTGGG + Intronic
1030214269 7:107027876-107027898 ATGGAGGAAATGGGAGGGGTAGG + Intergenic
1030879676 7:114861856-114861878 ATGAAAGAAAGGCCAAGGGTGGG - Intergenic
1030913523 7:115282708-115282730 AGGAAGGAAAGGGCTGGGTTTGG + Intergenic
1030923344 7:115420192-115420214 AAGGAAGAAAGGCCTGAAGTTGG + Intergenic
1031901633 7:127417688-127417710 AAGGAGGAAAGACCTGGGAGAGG + Intronic
1031925779 7:127636888-127636910 CTGGAGGAGAGGTCTGGGCTGGG + Intergenic
1032474330 7:132202113-132202135 ATGGAGCAAAGACCTGGGGGAGG - Intronic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1034016903 7:147597322-147597344 ATGGAGGATAAGGCTGGGTTGGG - Intronic
1034392817 7:150800078-150800100 CGGGAGGAGAGGCCTGGGGCTGG - Intronic
1034402792 7:150876953-150876975 GTGGGGGAAAGGCGGGGGGTGGG - Intergenic
1034864833 7:154632315-154632337 ATGGAGGAGAGGCCTGACTTAGG + Intronic
1035564457 8:631856-631878 ACTGAGCAAAGGCCTGGGGCGGG - Intronic
1036379623 8:8228372-8228394 ATGAGGGCGAGGCCTGGGGTAGG - Intergenic
1036638431 8:10567034-10567056 TGGGAGGAAAGGGCTGGGGTAGG - Intergenic
1037156589 8:15707961-15707983 ATGGAGGCAAAGACTGGAGTGGG - Intronic
1038164108 8:25068069-25068091 ATGGAGGAAGGGCGTGGGCTGGG - Intergenic
1038789842 8:30658354-30658376 AACGAGGGAAGGGCTGGGGTGGG + Intergenic
1038854159 8:31313258-31313280 GTGGAGGGAAGGCCAAGGGTAGG + Intergenic
1039086134 8:33781851-33781873 AAGGAGGCAAGGGCTGAGGTGGG + Intergenic
1039434786 8:37552607-37552629 AGGGAAGACAGGCCTGGGCTGGG - Intergenic
1040607658 8:48950759-48950781 GTGGAGAAAAGGTCTGGGATGGG - Intergenic
1040894004 8:52346886-52346908 AAGGAGGAAACGGCTGGAGTAGG + Intronic
1041342058 8:56856463-56856485 TCGGGGGAAATGCCTGGGGTGGG + Intergenic
1041426063 8:57721937-57721959 AGGGAGGAAAGGGGTGTGGTAGG - Intergenic
1042567176 8:70123897-70123919 ATGGAGGACAGCCCTGACGTAGG + Exonic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043918198 8:85949084-85949106 ATGGAGGAAAGTCCCGTGGAAGG - Intergenic
1043983397 8:86666399-86666421 GTAGAGGCAAGGCCTGGGTTAGG + Intronic
1044243883 8:89918503-89918525 ATGAAGAAAAGACCTGGGCTTGG - Intronic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1046761207 8:118022836-118022858 ATGGAGGTAATGCCTGGGGAAGG + Intronic
1046826334 8:118695859-118695881 TTGGAGGAGTGGCCTGGGGTAGG - Intergenic
1047248742 8:123166121-123166143 GGGGAGGAAGGGCCTGTGGTGGG + Intergenic
1047689534 8:127337474-127337496 AAGGAGGCAATGCCTGGGGAAGG - Intergenic
1048469636 8:134695516-134695538 ATGCAGGCAGGGCCTGGGGGTGG - Intronic
1048780122 8:137990835-137990857 AGGGTGGCAAGGCCTGGGTTGGG - Intergenic
1048846489 8:138607533-138607555 ATGGAGGTAGGGACGGGGGTGGG - Intronic
1049166589 8:141129420-141129442 ATGGAGGAAGGGTTGGGGGTGGG - Intronic
1049222105 8:141432907-141432929 ATGGAGGCGGGGCCTGGGGGGGG + Intergenic
1049325216 8:142018039-142018061 AGGCAGGCAGGGCCTGGGGTGGG - Intergenic
1050285847 9:4100974-4100996 ATGGAGGAAGGAACTGGGCTGGG + Intronic
1050618663 9:7429683-7429705 TTGGAGCTAAGGCCTGGAGTGGG + Intergenic
1051434228 9:17013782-17013804 GTGGGAGAAAGGCCAGGGGTAGG + Intergenic
1052982980 9:34462334-34462356 ATGAAGGAAAGATTTGGGGTAGG - Intronic
1053072519 9:35109655-35109677 AAGGAGGAAAAGTCTTGGGTAGG - Exonic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053205090 9:36179439-36179461 TTGGAGGAGAGGCCCGGTGTGGG - Intergenic
1053265483 9:36710044-36710066 ATTGAAGGAAGGCCTGGTGTGGG + Intergenic
1053277569 9:36794888-36794910 ATGGAGGAGGGGTCCGGGGTGGG - Intergenic
1053429231 9:38031029-38031051 ATGAAGGAAAGGGCTGGGCATGG + Intronic
1053432575 9:38052794-38052816 ATGGAGGAGAAGCCAGGTGTGGG - Intronic
1053474927 9:38375822-38375844 TGGGAGCAAAGGCCTGGGGTAGG - Intergenic
1054823066 9:69543283-69543305 GTGGAGGACAGGCCGGGGGGGGG - Intronic
1055606632 9:77977355-77977377 AAGGAAGAAAGTCTTGGGGTAGG - Intronic
1056455257 9:86753548-86753570 GTGGGGGAAAGGCCTGGAATAGG + Intergenic
1056485917 9:87058118-87058140 TTGGAGGCAAGGACTGGTGTGGG + Intergenic
1056847500 9:90053637-90053659 ATGGTGGGAAGGCCAGGGGCAGG - Intergenic
1057186714 9:93061192-93061214 TTGGAGGAAGGGCCTGGAGAGGG + Intronic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1058288550 9:103209876-103209898 ATGGAGGAAAAATATGGGGTTGG - Intergenic
1058692511 9:107531623-107531645 ATGGGGGAAAGGATTGGGGGTGG - Intergenic
1059095085 9:111404477-111404499 TTGGAGGAGAGGCCTGGTGGGGG + Intronic
1059366706 9:113791972-113791994 ATGCAAAAAAGGCCTGGGCTTGG + Intergenic
1060745084 9:126126043-126126065 ATGGATGGAAAGGCTGGGGTGGG - Intergenic
1061043584 9:128152881-128152903 GTGGGAGAAAGGCCTGGGGAGGG - Intronic
1061088679 9:128414017-128414039 GTAGAGCAAAGGCCCGGGGTGGG - Intronic
1061505705 9:131030791-131030813 AAGGAGCTGAGGCCTGGGGTGGG - Intronic
1061646595 9:132007756-132007778 ATGGAGACAAGGCCAGGAGTAGG + Intronic
1061942718 9:133891861-133891883 ATGGAGGGGAGGCATGGGGATGG + Intronic
1062033292 9:134371682-134371704 ATGGAGGACGGGCCTGGGGGTGG + Intronic
1062244110 9:135554828-135554850 GTGGACGAAAAGCATGGGGTTGG - Intergenic
1062442311 9:136576276-136576298 ATGGAGGGAAGGCAGGGGGCTGG - Intergenic
1203663423 Un_KI270754v1:3717-3739 GTGTAGGAAAGGCTTGGTGTAGG + Intergenic
1203663426 Un_KI270754v1:3733-3755 GTGTAGGAAAGGCTTGGTGTAGG + Intergenic
1185843541 X:3416109-3416131 ATGGATGAAAGGCCTCTGGAGGG - Intergenic
1187529971 X:20087366-20087388 AGGGAGGAAAGGCATGTGCTGGG - Intronic
1189206012 X:39239418-39239440 ATGGAGGAGTGGCATGGGATGGG + Intergenic
1189270253 X:39746522-39746544 ATTGAGGAAATGCCTGGGAAAGG - Intergenic
1189318549 X:40073369-40073391 AGGGAGGTAACTCCTGGGGTAGG + Exonic
1189339926 X:40197164-40197186 CTGGAGCAAGGGCCTGGGGCTGG - Intergenic
1189628243 X:42921917-42921939 AAGGAGCCAGGGCCTGGGGTTGG - Intergenic
1190681468 X:52830352-52830374 ATGGAGGAAAGAGCAGGGGGAGG - Intergenic
1190726935 X:53195876-53195898 CTGGACTGAAGGCCTGGGGTGGG + Intronic
1190998558 X:55636392-55636414 ATGGAGGAAAGAGCAGGGGTAGG - Intergenic
1192180264 X:68911952-68911974 ATGGGGAAAGGGTCTGGGGTTGG - Intergenic
1192432141 X:71119525-71119547 AAGGAGCAAAGGCCCTGGGTTGG + Intronic
1193221764 X:78934970-78934992 ATGGAGGAAGGGGCTGCGGGAGG + Intergenic
1194170814 X:90578678-90578700 ATGGTGGAAAGGCGAGGGCTGGG - Intergenic
1198216223 X:134557071-134557093 AGGGAGGGAATACCTGGGGTGGG - Intergenic
1198797359 X:140411087-140411109 ATGAATGAGAGCCCTGGGGTGGG - Intergenic
1199612566 X:149631118-149631140 CTGGAGGAAACAGCTGGGGTGGG + Intronic
1199766754 X:150946942-150946964 ATGGAGGAATGGGGTGGGGAGGG + Intergenic
1199830173 X:151541647-151541669 ATGGAGACAAGGGCTGGGGGAGG - Intergenic
1199882531 X:151986016-151986038 AGGGAGGAGAAGGCTGGGGTAGG - Intergenic
1200152057 X:153956096-153956118 AGGAAGGAAAGGCCTGTGGACGG + Intronic
1200517048 Y:4156416-4156438 ATGGTGGAAAGGCGAGGGCTGGG - Intergenic
1201231471 Y:11868783-11868805 ATGGATGAAAGGCCTCTGGAGGG + Intergenic
1201279884 Y:12332495-12332517 CTGCAGGAGAGGCCTTGGGTAGG + Intergenic