ID: 1033048005

View in Genome Browser
Species Human (GRCh38)
Location 7:137979906-137979928
Sequence GAAACTGATGTGGCCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033048005_1033048011 15 Left 1033048005 7:137979906-137979928 CCAGGGGAGGCCACATCAGTTTC 0: 1
1: 0
2: 3
3: 11
4: 134
Right 1033048011 7:137979944-137979966 CTTGATCTGGCATCAGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 124
1033048005_1033048009 2 Left 1033048005 7:137979906-137979928 CCAGGGGAGGCCACATCAGTTTC 0: 1
1: 0
2: 3
3: 11
4: 134
Right 1033048009 7:137979931-137979953 GGGCTCCATCTAGCTTGATCTGG No data
1033048005_1033048012 24 Left 1033048005 7:137979906-137979928 CCAGGGGAGGCCACATCAGTTTC 0: 1
1: 0
2: 3
3: 11
4: 134
Right 1033048012 7:137979953-137979975 GCATCAGTACCTGGTGCATGCGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033048005 Original CRISPR GAAACTGATGTGGCCTCCCC TGG (reversed) Intronic
900755484 1:4431588-4431610 GAAACTGATGCTGTCACCCCAGG + Intergenic
902677369 1:18018161-18018183 GAAACTGAAGCTCCCTCCCCAGG - Intergenic
903292560 1:22324040-22324062 GAGATTGATGTGGCCTCCCCGGG + Intergenic
904430431 1:30460772-30460794 GAAAATGATCTGCCATCCCCAGG + Intergenic
904467424 1:30716723-30716745 GGAGGTGATGGGGCCTCCCCAGG - Intronic
906481271 1:46200738-46200760 GAAACTGAAATGGCCTGCACTGG - Intronic
907501489 1:54884850-54884872 GAAACTGTTGGGGCCTCTGCAGG + Intronic
907929152 1:58982834-58982856 GAACCTGCTGTGGCCTCAGCTGG + Intergenic
912435573 1:109658747-109658769 TGCACAGATGTGGCCTCCCCAGG - Intronic
912645558 1:111388549-111388571 GAAGCTGATGTTCTCTCCCCAGG - Intergenic
914746339 1:150504358-150504380 CACACTGATGTGGCCGGCCCAGG - Exonic
918305961 1:183246331-183246353 GAAGGGGATGTGGCTTCCCCAGG + Intergenic
1064563878 10:16620465-16620487 GAACCAGATGTGGCCTCAGCAGG + Intronic
1067295923 10:44975187-44975209 GAAACGGAAGGGGCTTCCCCTGG + Intronic
1067811262 10:49428903-49428925 GACTCTGATATGTCCTCCCCCGG - Intergenic
1068065162 10:52121140-52121162 GAAACAGAGGTGTCCTGCCCTGG + Intronic
1068686682 10:59877547-59877569 GAAACTGATGTGGCCATCTGAGG + Intronic
1069540889 10:69293026-69293048 AAGACTGATTTGGCCTCCACTGG + Intronic
1069589183 10:69631183-69631205 GAGACTTAAGTGGCCTGCCCGGG - Intronic
1074366143 10:112859031-112859053 AAAACAGGTGTGGCCTTCCCGGG + Intergenic
1075297492 10:121291270-121291292 CAAACAGATGTGGCCTTTCCAGG + Intergenic
1076511138 10:131014437-131014459 GGAAAGGATGTGGCCTGCCCAGG - Intergenic
1079553574 11:21731689-21731711 GAAAGTTATGTGGCCTCATCTGG - Intergenic
1082854748 11:57796526-57796548 GAAACTGATGAAGCATCCACAGG - Exonic
1084032065 11:66487000-66487022 GCAACGGATGTGGCCTCCAGAGG - Intronic
1084681821 11:70670767-70670789 GAAACAGCAATGGCCTCCCCAGG - Intronic
1085394462 11:76200311-76200333 GGAACTGTTCTGGCCTGCCCTGG + Intronic
1088534048 11:110840476-110840498 GAGACTGATGTGGCCTCTGCAGG + Intergenic
1090828757 11:130406196-130406218 GAGACTGAAGTGGGCACCCCAGG + Intronic
1091702932 12:2676101-2676123 GAATCTGCTGTGGACTCTCCAGG - Intronic
1094822032 12:34233546-34233568 GAAACTGTGGTGGCCTCAGCAGG + Intergenic
1096053204 12:48629069-48629091 GAAACTGTAATTGCCTCCCCTGG + Intergenic
1099640665 12:85280041-85280063 GAAACTCAGCTGGCCTCCTCGGG - Intergenic
1100171827 12:91983862-91983884 GGAAGTGATTTTGCCTCCCCAGG + Intergenic
1100473794 12:94917212-94917234 GAAACTGCTCTGGCATCTCCAGG + Intronic
1103344670 12:120241373-120241395 AAAACAGATGTGGCCTCGCTTGG + Intronic
1104016601 12:124965934-124965956 GAGAATTATGTGGCCTGCCCCGG - Intronic
1106549697 13:30760534-30760556 GAAACAGCTGTGCCCTCCACAGG - Intronic
1110893160 13:80715180-80715202 GAAACTTATCTGGCCTCCATTGG - Intergenic
1112045808 13:95596532-95596554 GAAGCTGATGTGGCCTCTACAGG - Intronic
1113993546 14:16048762-16048784 GAAATTGATGTGCCATCCACCGG - Intergenic
1116728233 14:48589468-48589490 GAAACTGATGAGCCCTCTCAGGG - Intergenic
1119537089 14:75411331-75411353 GGAAATGAAGTGGCCTGCCCAGG + Intergenic
1122717618 14:103705163-103705185 AAAAGGGATGTGGCCTCCCAAGG - Intronic
1123000898 14:105293570-105293592 GACACTGATGTGGGCTCACAGGG + Intronic
1125605644 15:40938381-40938403 GGAGCTGCTGTGGCCTCCACTGG + Exonic
1126231513 15:46332170-46332192 GAAATGGAAGTTGCCTCCCCTGG + Intergenic
1129074292 15:72978431-72978453 GCAACAGATCTGTCCTCCCCTGG + Intergenic
1131486256 15:92823342-92823364 GCATCTGATTTGGTCTCCCCTGG + Intergenic
1131968404 15:97869377-97869399 GAAACTGATGTGGGTTTCTCTGG + Intergenic
1133607733 16:7404822-7404844 GAAACAGATGTGGGCTCTCCTGG + Intronic
1134910459 16:18021398-18021420 GAAATAGAGGTGGCCTCCACAGG + Intergenic
1136031735 16:27507986-27508008 GAAGGTGATGTGGCCACCCCGGG - Intronic
1139523247 16:67497369-67497391 GACACTTATGTGGACACCCCAGG + Intergenic
1141829243 16:86500496-86500518 GGAGCTGGTGGGGCCTCCCCAGG + Intergenic
1142234924 16:88917531-88917553 GGAACCGGTGTAGCCTCCCCTGG - Intronic
1142332939 16:89467186-89467208 CCACCTGCTGTGGCCTCCCCAGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1145923188 17:28626742-28626764 GAAGCTTCTGTGCCCTCCCCAGG - Intronic
1147736026 17:42638867-42638889 GATACTGATGTTGCCTGTCCGGG + Intergenic
1147969649 17:44212549-44212571 GACACTGATGTGACCTCCCATGG - Intronic
1151681838 17:75626506-75626528 GAAGAGGATGAGGCCTCCCCCGG + Intergenic
1151877884 17:76877591-76877613 GAGCCTGGTGTGGCCTCCCACGG + Intronic
1152874427 17:82778432-82778454 GAAACTCATGTGTCCTCCCCAGG - Intronic
1157730545 18:50000693-50000715 GACACAGATGGGGCCTGCCCTGG + Intronic
1160950388 19:1664068-1664090 CAACCTGGTGGGGCCTCCCCAGG - Intergenic
1161350750 19:3790190-3790212 GAAACTGGTGCGGCCACCTCTGG - Intronic
1164727923 19:30479222-30479244 GAAAATGATGAGGCTTCCACTGG - Intronic
1165421388 19:35723773-35723795 GAATCTCCTGAGGCCTCCCCTGG + Exonic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925960374 2:9008911-9008933 TAAATTGCTGTAGCCTCCCCAGG + Intergenic
926779239 2:16452234-16452256 GAAACTTCTGCGGCTTCCCCTGG + Intergenic
927945048 2:27130587-27130609 GAAGCCGATGTGGCCACCCCGGG - Exonic
934047036 2:88180791-88180813 GTTACTGCTCTGGCCTCCCCTGG + Intronic
936018324 2:108975984-108976006 AAAACTGGTGTGGGGTCCCCGGG - Intronic
938538135 2:132262106-132262128 GAAATTGATGTGCCATCCACCGG + Intergenic
941645024 2:168031100-168031122 GAAACTCCTCTGGCCTGCCCTGG + Intronic
941730603 2:168913071-168913093 GAAACTGAAGCGGCCTCCCTGGG + Intronic
946314990 2:218905322-218905344 GGAACTGAAGGGGCCTGCCCAGG - Intergenic
948844608 2:240677071-240677093 GGACCTGATGTGGCGTCCCAGGG + Intronic
948849252 2:240697808-240697830 GGACCTGATGTGGCGTCCCAGGG - Intronic
1171867041 20:30493891-30493913 GAAATTGATGTGCCATCCACCGG + Intergenic
1172845560 20:37928068-37928090 GACACGGCTGTGGCCTCTCCAGG - Intronic
1174368894 20:50073192-50073214 GGAACTGATGTGGCATGCCAAGG - Intergenic
1175072716 20:56347787-56347809 GCCACTGCTGCGGCCTCCCCTGG + Intergenic
1175290865 20:57874348-57874370 GAAGATGATGTGGGCTGCCCTGG + Intergenic
1176200049 20:63855999-63856021 GCAACTTCTGTGGCCTCCCGTGG + Intergenic
1179422565 21:41248363-41248385 GAATCTGAGGTGAGCTCCCCAGG + Intronic
1180079304 21:45479661-45479683 GAACCTGCTGTGACCTCCCGAGG + Intronic
1180313722 22:11258751-11258773 GAAATTGATGTGCCATCCACCGG + Intergenic
1182728328 22:32466980-32467002 GAAATTGATGTTGCCACCCGGGG - Intergenic
1185130354 22:49035362-49035384 GACCCTGATCTGGCCACCCCAGG - Intergenic
950004634 3:9683911-9683933 GAGACTGAGGTAGTCTCCCCTGG - Intronic
950670254 3:14521641-14521663 GAGTATGATGTGGCCACCCCTGG - Exonic
951313588 3:21160865-21160887 GAAAGTGATGTGGCTTGCCTAGG + Intergenic
952973628 3:38674414-38674436 GAAGATGGTGTGGCCACCCCAGG + Intergenic
953875759 3:46665980-46666002 GACACTGATGAGGCCTCCCTTGG + Intergenic
954696347 3:52429262-52429284 GAAACTGATGCTGTCTCCCTGGG - Intergenic
955345666 3:58159758-58159780 GAAACTGATCAGCCCTCCCTTGG - Intronic
955847291 3:63179304-63179326 GAAACTTAGCTGGACTCCCCAGG - Intergenic
956382371 3:68678481-68678503 GAAAGTTATGTAGCCTCTCCGGG - Intergenic
961155637 3:124677262-124677284 GAAACTGATGATGCCTGCTCAGG + Intronic
963501303 3:146130752-146130774 CAATGTCATGTGGCCTCCCCTGG + Intronic
964326235 3:155549056-155549078 CAAAATGATGTGGCCACCCAAGG + Intronic
966763191 3:183435138-183435160 AAAACTGTGATGGCCTCCCCTGG + Intergenic
971574954 4:28261192-28261214 GAAACTGAAGTGGCCTTACAGGG + Intergenic
973200295 4:47493693-47493715 GATACTGATGGGGCCTACTCTGG - Intronic
976773515 4:88681354-88681376 GAAACTGTTGTGGCTGCCTCTGG + Intronic
977894571 4:102348911-102348933 GAAACTCATTTGACCTCACCAGG + Intronic
981750974 4:148092058-148092080 GAAATTGCTGGGGCATCCCCGGG - Intronic
986475927 5:8132482-8132504 GAAACTGAGGTGGCCTCCCAGGG - Intergenic
988134029 5:27145584-27145606 GTAACTGATGTTGCCTGGCCTGG + Intergenic
988632699 5:32947773-32947795 GGAAGTGATGTGTCCTCTCCAGG - Intergenic
990337753 5:54791942-54791964 GTCACTGATGTGGGCTGCCCTGG + Intergenic
990358818 5:54997481-54997503 GAAACTGATCCTGTCTCCCCTGG - Intronic
992468265 5:77028914-77028936 TAAACTGATGTGGCCTTCTTTGG - Intergenic
992888555 5:81183176-81183198 GAAATCGAAGTGGCCTCCCTGGG - Intronic
998452551 5:142246071-142246093 GAAACTGGTGGTGGCTCCCCAGG - Intergenic
998955320 5:147432454-147432476 ACAAGTGATGTGGCCTGCCCTGG + Intronic
999864879 5:155690238-155690260 GAATCAGATGTGGCCTCACTAGG + Intergenic
1004724961 6:18302474-18302496 GAAACTGATGTGACCTGCCAAGG + Intergenic
1005533231 6:26729590-26729612 GGAGCTAATGTAGCCTCCCCTGG + Intergenic
1005537563 6:26772074-26772096 GGAGCTAATGTAGCCTCCCCTGG - Intergenic
1009008438 6:57814484-57814506 GGAGCTAATGTAGCCTCCCCTGG - Intergenic
1015421114 6:133009646-133009668 GAGACTGATGTGGCAGCCACAGG - Intergenic
1015936248 6:138407990-138408012 GAAATTGTTCTGCCCTCCCCAGG + Intronic
1017976082 6:159358676-159358698 AGAACTGATGAGGCCACCCCTGG + Intergenic
1019567724 7:1692884-1692906 GAAGCTGATGTGGCCCCCACTGG - Exonic
1020059791 7:5143753-5143775 GAAACTGATCCTCCCTCCCCTGG + Intergenic
1020168178 7:5823998-5824020 GAAACTGATCCTCCCTCCCCTGG - Intergenic
1024938682 7:54739794-54739816 GAAACGGAGGTGGGCTCCACAGG + Intergenic
1029990363 7:104957660-104957682 GAACCTGATATGGCTTCCCTTGG - Intergenic
1033048005 7:137979906-137979928 GAAACTGATGTGGCCTCCCCTGG - Intronic
1037114173 8:15203395-15203417 GAAACTGCAGTGGCCTCACGGGG - Intronic
1037918240 8:22785736-22785758 CAGACTGAGGTGGCCTCTCCGGG - Intronic
1041700126 8:60779452-60779474 GAAGGTGATGTGGCCACCCCAGG - Intronic
1049743956 8:144255153-144255175 AAACATGAAGTGGCCTCCCCTGG - Intronic
1051618933 9:19032692-19032714 AGAACTGATGTGGCGTCCGCGGG + Intronic
1052197111 9:25731582-25731604 GAAACTGATGTGACCTGCTTTGG + Intergenic
1060818875 9:126650440-126650462 GATGCTGATGTGGCCCTCCCTGG + Intronic
1061594829 9:131622030-131622052 TTCCCTGATGTGGCCTCCCCCGG - Intronic
1187971085 X:24659405-24659427 CAAACAGAAGTGGCCTCACCAGG + Intronic
1194524856 X:94966604-94966626 GAAACTGTGGTGGCCCCCACAGG - Intergenic
1195617162 X:106921525-106921547 GGAACTGATGTGGCCTTCTGGGG - Intronic
1197070477 X:122290890-122290912 TAAACTTGAGTGGCCTCCCCTGG + Intergenic
1197346313 X:125327894-125327916 AGGCCTGATGTGGCCTCCCCTGG - Intergenic
1198533291 X:137565624-137565646 GAAACTGCTGCGCTCTCCCCAGG + Intergenic
1201767804 Y:17589010-17589032 GAAACTGTGGTGGCCTCAGCTGG + Intergenic
1201833749 Y:18316975-18316997 GAAACTGTGGTGGCCTCAGCTGG - Intergenic