ID: 1033048175

View in Genome Browser
Species Human (GRCh38)
Location 7:137981028-137981050
Sequence CCGAGTCCTTGCAATAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033048171_1033048175 -4 Left 1033048171 7:137981009-137981031 CCAAGATCTGCTGAGGACCCCGA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG No data
1033048169_1033048175 4 Left 1033048169 7:137981001-137981023 CCAGAATGCCAAGATCTGCTGAG 0: 1
1: 0
2: 0
3: 6
4: 172
Right 1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG No data
1033048168_1033048175 7 Left 1033048168 7:137980998-137981020 CCTCCAGAATGCCAAGATCTGCT 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG No data
1033048166_1033048175 22 Left 1033048166 7:137980983-137981005 CCAATAATGTGACACCCTCCAGA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG No data
1033048167_1033048175 8 Left 1033048167 7:137980997-137981019 CCCTCCAGAATGCCAAGATCTGC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033048175 Original CRISPR CCGAGTCCTTGCAATAAAGC AGG Intronic
No off target data available for this crispr