ID: 1033048315 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:137982022-137982044 |
Sequence | ATGGGGCTGCACAATGAGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1033048303_1033048315 | 22 | Left | 1033048303 | 7:137981977-137981999 | CCAGCAGCAAGAGGGAGCAGAGC | 0: 1 1: 0 2: 10 3: 41 4: 322 |
||
Right | 1033048315 | 7:137982022-137982044 | ATGGGGCTGCACAATGAGGTGGG | No data | ||||
1033048302_1033048315 | 23 | Left | 1033048302 | 7:137981976-137981998 | CCCAGCAGCAAGAGGGAGCAGAG | 0: 1 1: 0 2: 4 3: 53 4: 418 |
||
Right | 1033048315 | 7:137982022-137982044 | ATGGGGCTGCACAATGAGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1033048315 | Original CRISPR | ATGGGGCTGCACAATGAGGT GGG | Intronic | ||
No off target data available for this crispr |