ID: 1033048315

View in Genome Browser
Species Human (GRCh38)
Location 7:137982022-137982044
Sequence ATGGGGCTGCACAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033048303_1033048315 22 Left 1033048303 7:137981977-137981999 CCAGCAGCAAGAGGGAGCAGAGC 0: 1
1: 0
2: 10
3: 41
4: 322
Right 1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG No data
1033048302_1033048315 23 Left 1033048302 7:137981976-137981998 CCCAGCAGCAAGAGGGAGCAGAG 0: 1
1: 0
2: 4
3: 53
4: 418
Right 1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033048315 Original CRISPR ATGGGGCTGCACAATGAGGT GGG Intronic
No off target data available for this crispr